Labshake search
Citations for New England Biolabs :
151 - 200 of 3434 citations for Mouse Anti Human Immunodeficiency Virus HIV 1 gp41 1911 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2022Quote: ... anti-MBP (1:10,000, catalog no. E8032S, New England Biolabs); anti-CCNA2 (1:1000 ...
-
bioRxiv - Cell Biology 2022Quote: ... rabbit anti-GFP (1:1000; TP401, Torrey Pine Biolabs, RRID:AB_10013661), mouse anti-GFP (1:1000 ...
-
bioRxiv - Plant Biology 2022Quote: ... Gel blots were analysed using anti-MBP (NEB, 1:10.000) and anti-GST antibodies (Santa Cruz Biotechnology ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-L-lactyllysine (pan-Kla, PTM BIOLABS, PTM1401, 1:1000), anti-H3K9la (PTM BIOLABS ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 1 μl anti-MBP Monoclonal Antibody (New England Biolabs, #E8032L) and 6 μl anti-E ...
-
bioRxiv - Immunology 2022Quote: ... with short homologies for Gibson assembly and cloned into human IgG1 or human IgL2 expression vectors using the NEB Hifi DNA Assembly mix (NEB, Cat#E2621L). Plasmid sequences were verified by Sanger sequencing (Genewiz).
-
The conserved metalloprotease invadolysin is present in invertebrate haemolymph and vertebrate bloodbioRxiv - Cell Biology 2019Quote: ... Human plasma was treated with PNGase F (NEB; P0704S) or a mixture of O-Glycosidase (NEB ...
-
bioRxiv - Biophysics 2020Quote: ... as with commercially available human H1 (hH1) (M2501S; NEB), sharing 96.5% identity with mH1 (Fig ...
-
bioRxiv - Biochemistry 2023Quote: ... and human casein kinase II (New England BioLabs, #P6010).
-
A crucial role for dynamic expression of components encoding the negative arm of the circadian clockbioRxiv - Biochemistry 2023Quote: ... Recombinant human Histone H2A (New England BioLabs, Catalog # M2502S) or H4 (New England BioLabs ...
-
bioRxiv - Microbiology 2021Quote: ... or murine anti-MBP monoclonal antibody (1:10,000; NEB; catalog# E8032S) in the above LI-COR blocking buffer ...
-
bioRxiv - Microbiology 2022Quote: ... goat polyclonal anti-UIS4 (LS Biolabs LS-C204260; IFA 1:1000); rabbit polyclonal anti-LISP2 (IFA ...
-
bioRxiv - Biochemistry 2023Quote: ... and probed with either anti-histone H3 (1:1000, NEB, 9715S) or anti-histone H3 (phosphor S10 ...
-
bioRxiv - Immunology 2020Quote: CAR-encoding mRNA was transcribed from linearized plasmids encoding anti-human CD19 CAR61 and anti-mouse CD19 CAR71 using T7 RNA polymerase (HiScribe™ T7 High Yield RNA Synthesis Kit, New England Biolabs). The mRNAs were transcribed to contain the 5′ UTR derived from the human a-globin 5′ leader RNA ...
-
bioRxiv - Microbiology 2023Quote: ... The cells were washed three times with a PBS buffer 1X and then incubated with mouse anti-MBP (NEB, Cat# E8032L) or rabbit anti-V5 (Cell Signaling Technology ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and anti-Phospho-histone H3 1:100 (New England Biolabs, Ipswich, USA) and secondary antibodies AlexaFluorTM 488 goat anti-chicken and AlexaFluorTM 594 goat anti-rabbit IgG (Life Technologies ...
-
bioRxiv - Developmental Biology 2021Quote: ... rabbit anti-SNAP (1:1000, polyclonal, New England Biolabs, Ipswich, MA, P9310S), or mouse anti-tubulin (1:40,000 ...
-
bioRxiv - Developmental Biology 2020Quote: ... 75°C) with 0.5 μg mouse Cot-1 DNA supplemented with 10 mM vanadyl ribonucleoside complex (VRC) (NEB, S1402S) and 0.2 U μL−1 RNAseOUT (Invitrogen ...
-
bioRxiv - Biochemistry 2023Quote: ... The coding sequence of mouse PADI4 (residues 1-666) was amplified and cloned into pET28a vector using NdelI (NEB) and XhoI (NEB ...
-
bioRxiv - Biophysics 2020Quote: Recombinant wild-type human histone H1.0 (New England Biolabs, cat. # M2501S) was used for experiments with fluorescently-labeled nucleosomes ...
-
bioRxiv - Biochemistry 2021Quote: Recombinant human CHIP was expressed in BL21(DE3) (New England Biolabs) E ...
-
bioRxiv - Cell Biology 2024Quote: ... coli-derived recombinant human histone H1 (NEB, Ipswich, MA, USA #M2501), H2A (NEB ...
-
bioRxiv - Developmental Biology 2021Quote: Subcloning Both full-length and truncated (1-160) mouse Naa12 were amplified from the pMAL-c5x Naa12 plasmid using Q5 HF Master Mix (NEB), AAAACCCGGGTATGAACATCCGCCGGGCTCGGC as the forward primer ...
-
bioRxiv - Neuroscience 2020Quote: ... + 5 % non-fat milk for 1 hour at room temperature before incubating with primary antibody: anti-GFP (1:1000, Biolabs) or anti-actin (1:5000 ...
-
bioRxiv - Microbiology 2023Quote: ... The membrane was washed three times in TBS-T for 5 min each before incubation for 1 h with secondary antibody (anti-rabbit IgG HRP, 1:5000 dilution, 7074S, NEB) in TBS-T with 1% (w/v ...
-
bioRxiv - Cell Biology 2022Quote: ... Afterwards 2 µg of recombinant human Histone H3.1 (New England BioLabs, M2503), 100 µM S-(5′-adenosyl)-L-methionine chloride dihydrochloride (SAM ...
-
bioRxiv - Genomics 2019Quote: ... Human genomic DNA was fragmented by a dsDNA fragmentase (New England Biolabs) followed by end preparation and adapter ligation according to the NEBNext Ultra II DNA Library Prep Method for Illumina (New England Biolabs).
-
bioRxiv - Biochemistry 2022Quote: ... The coding region of human Cdc20N was cloned by USER® (NEB) into a modified pRSFDuet-1 vector (71341-3 ...
-
bioRxiv - Microbiology 2022Quote: ... or PCR amplified from human cDNA using Vent Polymerase (New England Biolabs), then introduced into the luciferase with an intron construct at the EcoRI site ...
-
bioRxiv - Molecular Biology 2023Quote: ... Rabbit polyclonal anti-SNAP-tag (Cat no. P9310S, New England Biolabs, 1:1000 dilution). Secondary antibodies used were ...
-
Spatial visualization of A-to-I Editing in cells using Endonuclease V Immunostaining Assay (EndoVIA)bioRxiv - Molecular Biology 2024Quote: ... Cells were then incubated for 1 hour with anti-MBP antibody (New England BioLabs) solution diluted in calcium containing blocking buffer ...
-
bioRxiv - Neuroscience 2023Quote: ... The primary antibodies used were anti-PDGF-Ra (rabbit, New England Biolabs, 1:400 dilution), anti-APC (clone CC1 ...
-
bioRxiv - Biochemistry 2023Quote: ... The membrane was then probed with the primary anti-MBP antibody (NEB E8032S, 1:10000) diluted in 5% NFDM (overnight ...
-
bioRxiv - Molecular Biology 2019Quote: ... Purified human gDNA was digested with the restriction enzyme HaeIII (NEB, Ipswich, Massachusetts) per the manufacturer’s instructions to yield an average of 347-bp DNA fragments22 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Human FBP1 mutants were constructed by Q5 Site-Directed Mutagenesis Kit (NEB, E0554S) in the PCDH-V5-FBP1 vectors ...
-
bioRxiv - Biophysics 2022Quote: Recombinant wild-type human histone H1.0 was used (H1; New England Biolabs M2501S). ProTαC and unlabeled ProTα were prepared as previously described (26) ...
-
bioRxiv - Neuroscience 2020Quote: ... After overnight incubation at 4°C in PBS-Perm with rabbit anti-GFP (1:1000, Biolabs) and mouse anti-MAP2 (1:2000 ...
-
bioRxiv - Neuroscience 2023Quote: ... Primary antibodies used for immunoblots in this study were anti-tau (tau46) (1:5000; NEB 4019S), anti-human tau (tau13 ...
-
bioRxiv - Immunology 2021Quote: ... Libraries were prepared using the NEBNext Immune Sequencing Kit for Human (New England Biolabs) according to the manufacturer’s instructions without modifications ...
-
bioRxiv - Genomics 2020Quote: ... the circularized DNA was initially treated with human alkyl adenine DNA glycosylase (hAAG, NEB) to cleave the N-glycosidic bond of etheno-dA bases ...
-
bioRxiv - Cell Biology 2020Quote: ... The primary antibodies used in this study were rabbit anti-GLuc 1:2,000 (E8023S, New England Biolabs), rabbit anti-epidermal growth factor receptor (EGFR) ...
-
bioRxiv - Cell Biology 2019Quote: ... Fusions to the human O6-Alkyl-DNA transferase (SNAP-tag, New England Biolabs, Beverly, MA) were expressed from plasmid pAGT-Xpress ...
-
bioRxiv - Genetics 2020Quote: ... ~15nM (3ug) human genomic DNA or 30ng of gBlock in 1x Cutsmart buffer (NEB B7204) was incubated at 37°C for 15 minutes.
-
bioRxiv - Cell Biology 2023Quote: Human ARHGAP18 constructs were created using Polymerase Chain Reaction (PCR) using New England Biolabs (NEB) Phusion High-Fidelity PCR Kit (catalog no ...
-
Striated muscle-specific base editing enables correction of mutations causing dilated cardiomyopathybioRxiv - Genetics 2022Quote: DNA from human cells was isolated using the Monarch®Genomic DNA Purification Kit (NEB) following the manufacturer’s instructions and including the recommended RNaseA digestion step ...
-
Striated muscle-specific base editing enables correction of mutations causing dilated cardiomyopathybioRxiv - Genetics 2022Quote: RNA from human cells was isolated using the Monarch®Total RNA Miniprep Kit (NEB) following the manufacturer’s instructions and including the on-column DnaseI digestion ...
-
bioRxiv - Cell Biology 2021Quote: SNAP-GCGR was detected with an anti-SNAP-tag rabbit polyclonal antibody (P9310S, New England Biolabs, 1/500) followed by goat anti-rabbit IgG H&L HRP (ab6271 ...
-
Nonsense Mediated RNA Decay Is a Unique Vulnerability of Cancer Cells with SF3B1 and U2AF1 MutationsbioRxiv - Cell Biology 2021Quote: ... was detected by addition of 1 nM Europium-labeled anti-p53 phosphoserine 15 antibody (New England Biolabs/ Cisbio) and 40 nM streptavidin-conjugated APC (Prozyme ...
-
bioRxiv - Plant Biology 2022Quote: ... and the ubiquitinated ERECTA_CD were detected by IB analysis with anti-MBP (E8032, 1:10,000, New England Biolabs) as primary antibody ...
-
bioRxiv - Neuroscience 2024Quote: ... Sections were incubated with primary antibody rabbit anti-c-Fos (1:3000, New England Biolabs cat. No. 2250S) for 24 hours at room temperature ...