Labshake search
Citations for New England Biolabs :
151 - 200 of 292 citations for M CSF Mouse since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... 2μg RNA was used to generate library cDNAs using the enzyme M-MuLV Reverse Transcriptase (New England, Biolabs, USA) together with an RNase inhibitor (New England ...
-
bioRxiv - Developmental Biology 2024Quote: ... Total cDNA for RT-qPCR was generated from 1.5 µg total RNA using a random primer mix and M-MuLV reverse transcriptase (New England Biolabs) according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2021Quote: ... 1 μg of RNA was reverse transcribed in cDNA using random hexamers and M-MuLV reverse transcriptase (New England Biolabs). Quantitative PCRs were assembled with Absolute QPCR ROX Mix (Thermo Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... human emerin was first fused to the C-terminus of a SNAP tag by AscI and XhoI insertion in a pSNAP-tag(m) plasmid (NEB). SNAP-emerin was then subcloned into a modified pFUW lentiviral vector by NheI and AgeI insertion ...
-
bioRxiv - Molecular Biology 2021Quote: A CD22 cDNA fragment encoding the first two Ig-like domains fused to an EK-hIgG-Fc fragment was amplified by PCR and cloned into the mammalian expression vector pACP-tag(m)-2 (New England Biolabs).
-
bioRxiv - Molecular Biology 2019Quote: ... Complementary DNA (cDNA) was synthesized from total RNA of all different time points with M-MuLV Reverse Transcriptase (NEB, M0253S) by following the manual of the manufacturer ...
-
bioRxiv - Genomics 2021Quote: ... end repair was carried out with a mixture of bead-immobilized T4 DNA polymerase and T4 polynucleotide kinase (both kind gifts of Dr. M. Xu, New England Biolabs) in a 20 µl volume of End Repair buffer ...
-
bioRxiv - Biochemistry 2020Quote: ... Cells were labelled with 2.5 μM (0.5 μM for dSTORM imaging) SNAP-Surface Alexa Fluor 546 or 647 (indicated as SNAP546 and SNAP647 in this study) (NEB) for 20 min and optionally counterstained with 1 μg/ml DAPI (4’,6-diamidino-2-phenylindole ...
-
bioRxiv - Immunology 2021Quote: ... Two restriction sites NheI at the 5’ end and BamHI at the 3’ end were incorporated into the CD4-polypeptide linker plasmid which was then inserted into pACP-tag(m)-2 plasmid (New England Biolabs) to obtain pACP-CD4 ...
-
bioRxiv - Microbiology 2021Quote: ... VN173 fused to NiV-M was generated by exchanging Ub from the previously described VN173-Ub (Pentecost et al., 2015) for NiV-M using the Gibson Assembly Cloning Kit (New England BioLabs). MeV-M BiFC constructs were made by exchanging NiV-M fused to VN173 or VC155 for MeV-M using the Gibson Assembly Cloning Kit (New England BioLabs) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... cDNA was synthesized from 1 μg of total RNA using M-MuLV Reverse Transcriptase and Random Primers 6 (both New England Biolabs) at 42 °C for 60 min and diluted in 1:4 ratio by PCR grade water ...
-
bioRxiv - Microbiology 2020Quote: ... single-stranded cDNA was synthesized from 10 µg of RNA using 100 pM random hexamer primer (Integrated DNA Technologies) and M-MuLV Reverse Transcriptase (New England Biolabs). After reverse transcription ...
-
bioRxiv - Biochemistry 2022Quote: ... accordingly to manufacturer’s instructions and 1 μg of RNA was reverse-transcribed into cDNA using M-MuLV reverse transcriptase (New England Biolabs) and random hexamers ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA chimera was then cloned into the pACP-tag (m)-2 vector (addgene# 101126) using NheI and NotI (NEB) as the restriction sites ...
-
bioRxiv - Molecular Biology 2019Quote: 100µM of the synthesized phosphopeptides (Aapptec) or non-phosphorylated peptides were incubated with 350units of recombinant GSK3β (New England Biolabs) and cold kinase buffer ...
-
bioRxiv - Molecular Biology 2019Quote: ... First strand cDNA synthesis was performed for one hour at 42 °C using M-MuLV Reverse Transcriptase (New England Biolabs). Reactions were then mixed with 10 pmol of GRIA2 forward primer (5’ GGGATTTTTAATAGTCTCTGGTTTTCCTTGGG 3’ ...
-
bioRxiv - Bioengineering 2019Quote: ... First-strand cDNA was synthesized using a random hexamer primer and M-MuLV reverse transcriptase (RNase H-; New England Biolabs). Second-strand cDNA synthesis was subsequently performed using DNA polymerase I and RNase H ...
-
bioRxiv - Molecular Biology 2019Quote: ... the RNA was mixed with 10 µM of custom 5’ adapter and the ligation reaction was done using T4 RNA ligase 1 (M0437M, NEW ENGLAND BIOLABS) and with RNasin Plus ...
-
bioRxiv - Biophysics 2019Quote: ... final products were separated from non-ligated fragments by electrophoresis using a 0.8-1.5% (m/V) agarose gel and extracted from the gel with the Monarch® DNA Gel Extraction Kit (NEB).
-
bioRxiv - Developmental Biology 2022Quote: ... using 200-300 ng of purified RNA as template and Moloney Murine Leukemia Virus (M-MuLV) Reverse Transcriptase (M0253, NEB). cDNA was synthesised using the standard first strand synthesis protocol with random hexamers (S1230 ...
-
bioRxiv - Cell Biology 2022Quote: ... treatment on the total RNA was performed and cDNAs were generated using the M-MuLV Reverse Transcriptase and random primers (NEB), as per the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... We generated cDNA with random hexamers for qRT-PCR) or oligo(dT) primers for RT-PCR using M-MLV (NEB). We carried out semi-quantitative RT-PCR using DreamTaq (Thermo Fisher) ...
-
bioRxiv - Physiology 2023Quote: ... was obtained by reverse transcription (RT) using 1 μg of RNA and Moloney murine leukaemia virus (M-MuLV) reverse transcriptase (M0253, NEB), using the first strand cDNA synthesis standard protocol with random primers (S1330 ...
-
bioRxiv - Immunology 2023Quote: ... cDNA was synthesized from 1 μg of RNA using the ProtoScriptTM M-MuLV Taq RT-PCR kit and random primers (New England BioLabs). Quantitative PCR using SYBR select master mix (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2023Quote: ... The reduced and alkylated samples were then diluted by adding 70 μL of 50 mM ABC (so that the final urea concentration was 5.5 M) and 20 ng/μL of LysC (New England Biolabs, P8109S) to each sample ...
-
bioRxiv - Neuroscience 2024Quote: ... a ∼1500bp genomic sequence flanking the Ten-m start codon (∼750bp each side) was amplified using the Q5 hot-start high-fidelity DNA polymerase (New England Biolabs) and inserted into the pCR-Blunt-TOPO vector (Thermo Fisher) ...
-
bioRxiv - Neuroscience 2022Quote: ... Ribo-Zero Gold (Human/Mouse/Rat) Kit (Illumina; NEBNext® rRNA Depletion Kit (Human/Mouse/Rat)(E6350, NEB); NEXTflex™ Small RNA Sequencing Kit v3 (PerkinElmer ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse monoclonal anti-MBP (1:2000, NEB), rabbit polyclonal anti-Spo11 (1:1000 ...
-
bioRxiv - Biochemistry 2022Quote: ... MBP (mouse, 1:30,000, New England Biolabs), FLAG (mouse ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... lyrata respectively using 0.2 µM primers designed against ASY3 cDNA sequences obtained above (S5 Table) and Q5® High-Fidelity DNA Polymerase (New England Biolabs). PCR conditions were as follows ...
-
bioRxiv - Biochemistry 2020Quote: ... Cross-links were reversed from eluted chromatin by adding 6 μL of 5 M NaCl and 2 μL Proteinase K (NEB; P8107S) and incubation overnight at 65°C ...
-
bioRxiv - Microbiology 2021Quote: ... and the DNA-free samples consisting of RNA were converted to cDNA using M-MuLV Reverse Transcriptase kit (New England BioLabs, USA) according to the instructions provided by the supplier ...
-
bioRxiv - Biochemistry 2022Quote: ... and 4.5 μM biotinylated primer oligo IF238 (5/Biosg/TC TCC TCC TTC T) were annealed in T4 ligase reaction buffer (NEB B0202S). The mixture was heated to 75°C for 5 min and cooled to 4°C at a rate of −1°C min−1 ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 μl of the diluted samples was then denatured by addition of 4 M urea and Proteinase K (40 U/ml; New England Biolabs #P8107S), incubated for 5 min at 65°C ...
-
bioRxiv - Plant Biology 2021Quote: ... The pAB-M vector (DNA-Cloning-Service, Hamburg, Germany) was digested with SpeI and Gibson Assembly (NEB, Frankfurt am Main, Germany) was performed according to the manufacturer’s protocol using the beforehand amplified fragments to generate pSI56 ...
-
bioRxiv - Genomics 2023Quote: Nuclei were resuspended in 200 uL of Methylation Reaction Buffer (Buffer M containing 1mM S-adenosylmethionine (SAM)) (New England BioLabs B9003S). 10uL high-concentration EcoGII was added per 1e6 nuclei and the nuclei suspension was incubated at 37°C for 30 minutes ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-MBP (New England Biolabs, RRID:AB_ 1559738), used at 1:5000 ...
-
bioRxiv - Cancer Biology 2022Quote: ... mouse anti-PPARα (1:25, Arigo Biolabs ARG55240). Alexa Fluor conjugated secondary antibodies (ThermoFisher Scientific ...
-
bioRxiv - Biochemistry 2022Quote: ... and 0.01% Tween] to 3 µM concentration in a total volume of 50 µl and mixed with 20 μl of amylose beads (New England Biolabs, Ipswich, US-MA). After mixing the proteins and the beads ...
-
bioRxiv - Neuroscience 2020Quote: ... the first-strand of cDNA was synthesized using a random hexamer primer and M-MuLV reverse transcriptase (RNase H-) (New England BioLabs, Ipswish, MA, USA). Next ...
-
bioRxiv - Systems Biology 2023Quote: ... First-strand cDNA was subsequently synthesized using random hexamer primer and M-MuLV reverse transcriptase (RNase H-) (New England BioLabs, Ipswich, MA, USA). Next ...
-
Cdc42 promotes epithelial morphogenesis by coupling Par-complex and Crumbs recruitment via Par6-aPKCbioRxiv - Cell Biology 2019Quote: ... anti-MBP mouse 1/80,000 (E8032S, New England Biolabs). Western Blots were quantified using Fiji ...
-
bioRxiv - Neuroscience 2020Quote: ... mouse anti-myc (NEB/Cell Signaling, 2276; 1:1500) o/n at 4 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... Primary mouse antibodies against MBP (NEB E8032L, 1:5000) and RAD51 (Novus Biologicals 14b4 ...
-
bioRxiv - Cancer Biology 2019Quote: ... mouse monoclonal anti Pan-Keratin (clone C11, NEB, 4545S). Primary antibodies were incubated with sections overnight at 4°C except for anti-CD3 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... and NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... and reversely transcribed into cDNA from 1 μg of mRNA template using the M-MuLV cDNA Synthesis Kit (New England Biolabs, Frankfurt am Main, Germany) according to the protocol of the manufacturer ...
-
bioRxiv - Cell Biology 2023Quote: ... The DNA fragment encoding SNAP-tag was amplified from the pSNAP-tag (m) vector (a gift from New England Biolabs & Ana Egana, Addgene #101135), and then inserted into the pDisplay vector (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were stained with mouse anti-MBP (NEB, 1:500), followed by washing and subsequent incubation with goat anti-mouse IgG ...