Labshake search
Citations for New England Biolabs :
151 - 200 of 267 citations for L Asparagine H2O 13C4; D3; 15N2 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... The NEBNext Ultra Directional RNA Library Prep Kit for Illumina was used to process the samples according to the protocol NEB #E7420S/L (New England Biolabs) to fragments of 300-500 bps ...
-
bioRxiv - Molecular Biology 2020Quote: ... 10 μL RNA was mixed with 2 μL of 100 μM PvG748-SBS12-RT random hexamer primer (IDT) and 1 μL of 10 mM dNTP mix (NEB). The sample was incubated for 3 min at 65 °C and transferred to ice ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 μl of the cDNA was used as template for the RT-PCR reaction with OneTaq DNA Polymerase (New England Biolabs). PCRs were run at the following conditions ...
-
bioRxiv - Genetics 2021Quote: Amplified DNA was digested at 37 L for 2 h with the restriction enzyme StyI-HF (NEB, Ipswich, MA, USA) and products were run on a 0.8 % agarose gel stained with Invitrogen™ SYBR™ Safe DNA Gel Stain (Life Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... qRT-PCR was performed from 1µL of template RNA in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) with SARS-CoV-2 N-specific primers (EV Table 1 ...
-
BRD2 inhibition blocks SARS-CoV-2 infection by reducing transcription of the host cell receptor ACE2bioRxiv - Cell Biology 2021Quote: ... PCR was carried out in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) with SARS-CoV-2 N-specific primers (Forward 5′-TAA TCA GAC AAG GAA CTG ATT A-3′ ...
-
BRD2 inhibition blocks SARS-CoV-2 infection by reducing transcription of the host cell receptor ACE2bioRxiv - Cell Biology 2021Quote: ... were amplified in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) on a QuantStudio 6 Flex thermocycler ...
-
bioRxiv - Cancer Biology 2020Quote: ... We performed eight 100 µl PCR reactions per sample (4 µg DNA per reaction) using Q5 High-Fidelity 2x Master Mix (New England Biolabs)28 to maximize library sequencing quality ...
-
bioRxiv - Microbiology 2020Quote: ... 1 μl of the diluted cDNA was used in 10 μl reaction mixture of Q5 Hot START DNA Polymerase kit (NEB) (2 μl of 5X buffer ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μl of the supernatant as template DNA was mixed with 10 μl 2x Universal qPCR Master Mix (New England BioLabs) and 1 μl of each oligonucleotide (Table S5 ...
-
bioRxiv - Biochemistry 2020Quote: ... 20 µl of 2 U/µl Phusion polymerase and 160 µl of 40 U/µl Taq ligase (all enzymes from NEB). ddH2O was then added to a final volume of 1.2 ml.
-
bioRxiv - Biochemistry 2022Quote: ... 2 µL of the Klenow reactions were retrieved and added to 8 µL of 2x RNA Loading Dye (New England Biolabs). The mixtures were then analyzed by electrophoresis through a urea-15% polyacrylamide gel (Novex TBE-Urea gel 15% ...
-
bioRxiv - Physiology 2022Quote: ... 1 L of diluted extracts were incubated with 9 ml of packed amylose resin (catalog no. E8021S, New England Biolabs) and incubated at 4°C for 2h with gentle rotation ...
-
bioRxiv - Developmental Biology 2022Quote: Full-length cDNAs for wnt11b.L were amplified from wildtype or wnt11b-/- mutant oocyte total RNA using a high-fidelity polymerase (Q5, New England Biolabs). PCR products were cloned into pCR8/GW/TOPO (Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... Beads containing the repaired DNA were resuspended in 50 μL of 1X NEBuffer 2 containing 0.1 mM dATP and 25 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M), and incubated at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... End-repair reaction was cleaned using 1.8X Agencourt AMPure XP beads and eluted in 15 µl of EB that was used for A-tailing reaction in 30 µl of NEBNext dA-Tailing reaction buffer (NEB) with 7.5 units of Klenow fragment exo- (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... End-repair reaction was cleaned using 2X Agencourt AMPure XP beads and eluted in 16.5 μl of EB that was used for A-tailing reaction in 20 μl of NEBNext dA-Tailing reaction buffer (NEB) with 7.5 U of Klenow fragment exo-(NEB ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and 0.2 μl 50x oligos (AarI recognition site) for Level 0 and Level 2 cloning or Eco31I/BsaI-HFv2 (ThermoFisher Scientific/NEB) for Level 1 cloning ...
-
bioRxiv - Biochemistry 2021Quote: The α-(1,2)-Galf-containing N-linked glycans were released from 1 mg Transglucosidase L “Amano” (Amano) by using PNGase F (New England Biolabs) under denaturing conditions ...
-
bioRxiv - Microbiology 2021Quote: ... The L-sNTurboID fragment was ligated back to the pCEZ-L backbone using the same restriction sites Pac1 and Hpa1 by NEB T4 ligase.
-
bioRxiv - Genomics 2020Quote: ... Each reaction is performed in 50 μl at 30°C overnight with 2 μl of circulated DNA with 2.5 μL of 10 μM (each) dNTPs (Catalog number: N0446S Vendor: New England Biolabs Inc), 2.5 μL Rolling cycle primer (10 μM) ...
-
bioRxiv - Microbiology 2021Quote: ... We then used a 1690 bp synthetic fragment (gBlock Gene Fragments from IDT) containing the digested L gene sequences and EGFP to be inserted by Gibson Assembly (NEBuilder HiFi DNA assembly, NEB). The gBlock contained mutations to replace nucleotides CT at rCDVRIVenus(6 ...
-
bioRxiv - Immunology 2021Quote: ... 10 μl of the eluted PCR product was used in a final indexing using NEBNext Multiplex Oligos for Illumina (E7710S, NEB) following the manufacturer’s instruction ...
-
Evolution of protease activation and specificity via alpha-2-macroglobulin-mediated covalent capturebioRxiv - Synthetic Biology 2023Quote: ... 5 µl of the plasmid DNA served as template for a 50 µl PCR (Q5 High-Fidelity 2X Master Mix, NEB) with primers PK412+PK421 (input library ...
-
bioRxiv - Genomics 2023Quote: ... The nuclei were pelleted by centrifuging at 500 g for 5 min at 4 °C and resuspended in 200 μl 1X NEBuffer 2.1 (50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 100 μg/ml BSA; NEB, B7202) in a 1.5 ml tube ...
-
bioRxiv - Molecular Biology 2023Quote: ... Clarified lysate was applied to Glutathione Sepharose 4B affinity resin (1 ml bed volume per 2 l culture; New England Biolabs), and incubated with rotation for
-
bioRxiv - Developmental Biology 2023Quote: ... 2 μl of indexed P7 (Cao et al., 2017) and 20 μl of NEBNext High-Fidelity master mix (New England Biolabs) were added to each well and PCR performed as follows ...
-
bioRxiv - Molecular Biology 2024Quote: ... adding nuclease-free water to a final volume of 1 L) with 1:1000 (vol/vol) proteinase K (New England Biolabs) at 37°C for 1 h ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 µl from the PCR product were circularized using 1 µl T4 DNA ligase and 2 µl ligation buffer 10x (NEB) in a final volume of 20 µl ...
-
bioRxiv - Molecular Biology 2024Quote: 100 ng polyA+ RNA was annealed with 2 μl of 10 μM Oligo(dT)30VN primer (5’-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN-3’) and 2 μl of 10 mM dNTP mix (NEB) in 12 μl solution ...
-
bioRxiv - Microbiology 2023Quote: ... genomic DNA was extracted from 5-10 µl of the cell scrape and prepared for sequencing using the NEBNext Ultra II FS DNA Library Prep Kit (NEB) with the following modifications ...
-
bioRxiv - Microbiology 2023Quote: ... 2 µl of the Dpn I digested amplification product was transformed into 25 µl of NEB turbo competent E.coli (NEB, C2984). The desired mutation was initially confirmed by Sanger sequencing (Genomics Core Facility (UPF ...
-
bioRxiv - Neuroscience 2022Quote: ... RT-qPCR was performed from 1µL of template RNA in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) on a QuantStudio 6 Flex thermocycler (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Supernatant was incubated for 1 h with 50 µL anti-V5-tag mAb-Magnetic beads (#M167-11, MBL) blocked with 1 mg/mL BSA (#B9000S, New England Biolabs). Beads were washed seven times with lysis buffer ...
-
bioRxiv - Synthetic Biology 2023Quote: ... A 5 µL aliquot was taken in which primers and dNTPs were then inactivated using Exo-CIP Rapid PCR Cleanup Kit (NEB). From the resulting mixture ...
-
bioRxiv - Microbiology 2022Quote: ... Cells were then reverse crosslinked and lysed by adding 10μL of 10X Lysis-T (250mM EDTA, 2M NaCl, 10% Triton X-100) and 4μL of proteinase K (NEB, P8107S) and incubating at 55°C for 1 hour ...
-
bioRxiv - Microbiology 2024Quote: ... NEBNext Ultra II DNA Library Prep Kit for Illumina with NEBNext Multiplex oligos for Illumina (NEB cat # E7645S/L; E6440) following the instruction manual (V6.1_5/20 ...
-
bioRxiv - Developmental Biology 2024Quote: ... cDNA was diluted to 3ng/µl and 2µl per sample were added to a well containing 10µl Luna Universal Probe qPCR Master Mix (New England Biolabs, M3004), 1.6µl forward/reverse cyp1a primer ...
-
bioRxiv - Cancer Biology 2024Quote: ... perform 25-30 separate 100 µL reactions with 6-8 µg genomic DNA in each reaction using Q5 High-Fidelity DNA Polymerase (New England Biolabs) for around 18-20 cycles and then combine the resulting amplicons ...
-
bioRxiv - Molecular Biology 2024Quote: ... Beads containing the repaired DNA were resuspended in 50 μL of 1X NEBuffer 2 containing 0.1 mM dATP and 25 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M), and incubated at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... Library preparation was performed using the NEBNext® Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760S/L) as described for standard RNA-seq (42) ...
-
bioRxiv - Immunology 2024Quote: ... Next the cDNA is put through NEBNext Ultra II Non directional RNA Second Strand Synthesis Module (NEB Cat #E6111S/L). Finally a PCR clean up is done using the PureLink PCR Purification Kit (#K3100-01/02).
-
bioRxiv - Molecular Biology 2024Quote: ... Library preparation was performed using the NEBNext® Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760S/L). The workflow was adapted to generate longer library fragments by reducing the fragmentation time (see manual ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 µl of unpurified RT product was amplified in 20 µl using Q5 High-Fidelity 2X Master Mix (New England Biolabs) with 500 nM of each primer CCCTGTGGGTTTTACACTTAAAAAC and CTTCGTCCTTTTCTTGGAAGCGACA (Integrated DNA Technologies) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 µl of unpurified RT product was amplified in 10 µl using Q5 High-Fidelity 2X Master Mix (New England Biolabs) with 1 µM of each primer ...
-
bioRxiv - Genomics 2024Quote: ... PCR that was performed in 60 µl reactions as follows: 20 µl purified library was amplified with 1 µM NEBNext Universal PCR Primer for Illumina (NEB), 1 µM NEBNext Multiplex Oligos for Illumina (Index Primers Sets 1-4) ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 μl of the PCR product was mixed with 1X KLD Reaction Buffer and 1X KLD Enzyme Mix (New England Biolabs). The reaction mix was then used to transform BL21 chemically competent cells ...
-
bioRxiv - Bioengineering 2024Quote: ... Five ligation reactions (20 µL each) were set up using 100 ng DNA (3:1 ratio of library to backbone) and T4 ligase (NEB). Ligation occurred at room temperature for 30 minutes ...
-
bioRxiv - Biochemistry 2024Quote: ... DNA pellet was resuspended in 50 μL of TE buffer and 1 μL was used in qPCR reaction with Luna qPCR Master Mix (New England Biolabs).
-
bioRxiv - Genetics 2024Quote: ... concentration ≥ 1 ng/μl) were then subjected to poly(A) enrichment using the NEBNext Poly(A) mRNA Magnetic Isolation Module (New England Biolabs). Library preparation was carried out using the NEBNext UltraExpress RNA Library Prep Kit (New England Biolabs) ...