Labshake search
Citations for New England Biolabs :
151 - 200 of 2293 citations for D Ribitol 5 Phosphate Cytidylyltransferase ISPD CRPPA Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: ... 5 units of HindIII (NEB), and 6.33 uL of purified DNA ...
-
bioRxiv - Microbiology 2024Quote: ... coli NEB 5-alpha (NEB) cells stored at −80 °C were thawed on ice and transformed with the ligation mixture according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2024Quote: ... and 5 μM NAD+ (NEB) without or with 1mM CaCl2 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 5 µL rCutSmart buffer (NEB), and 1 µL CspCI (5,000 units/mL ...
-
bioRxiv - Genomics 2024Quote: ... 5-methyl-dCTP (NEB # N0356S), dATP ...
-
bioRxiv - Synthetic Biology 2024Quote: ... coli (NEB 5-alpha cells). Cells were plated onto LB plates containing 50 µg/mL kanamycin (LB-Kan) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... coli (NEB 5-alpha cells). Cells were plated onto LB plates containing 50 µg/mL kanamycin (LB-Kan) ...
-
bioRxiv - Cell Biology 2022Quote: 5’ Phosphorylated RA3 oligonucleotides were adenylated using 5’ DNA Adenylation Kit (New England BioLabs E2610S), by mixing 1 μL of 100 μM of 5’ Phosphorylated RA3 ...
-
bioRxiv - Microbiology 2020Quote: A template-switching 5’ rapid amplification of cDNA ends (5’-RACE) kit (New England BioLabs) was used to map the transcription start site of rflP ...
-
bioRxiv - Genomics 2020Quote: ... add 2 μl 10 mM dATP and 5 μl Klenow Fragment (3’ −> 5’ exo-) (NEB) to digest the unligated DNA fragments at 37°C for 40 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... Pre-adenylation was performed on 5 nmoles using the 5’ DNA Adenylation Kit (NEB, E2610L) as follows ...
-
bioRxiv - Molecular Biology 2022Quote: ... Unligated linkers were depleted by using 5 U per sample of 5’ deadenylase (NEB, #M0331S) and RecJ exonuclease (Biosearch Technologies ...
-
bioRxiv - Molecular Biology 2023Quote: ... IRES mRNAs were capped with the A(5’)ppp(5’)G cap analog (NEB # S1406L). Post-transcriptional polyadenylation was performed using E ...
-
bioRxiv - Immunology 2024Quote: ... 5’RACE PCR reaction mixes contained: 5 µl of Phusion 5X Buffer (New England Biolabs), 0.5 µl of 10 mM dNTP ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 pmol were 5′-end-labelled with [γ-32P]-ATP and T4 polynucleotide kinase (NEB). The labeled oligo was mixed in equimolar concentrations with the unlabeled reverse complement and annealed by heating at 100°C in a water bath followed by slow cooling ...
-
bioRxiv - Cell Biology 2020Quote: Glands were dissected in cold PB+RVC (100 mM Na Phosphate Buffer pH 7.2, 10 mM Ribonucleoside-vanadyl complex; New England Biolabs, Ipswich, MA). During dissection ...
-
bioRxiv - Systems Biology 2023Quote: ... RNA is subsequently ligated with an “RNA Phosphate Modified” (RPM) adaptor (Quinodoz et al 2021) using High ConcentrationT4 RNA Ligase I (NEB, M0437M). Beads were incubated at 24°C for 1 hour 15 minutes with shaking at 1400 rpm ...
-
bioRxiv - Cancer Biology 2021Quote: ... mRNAs were enriched using Oligo d(T)25 Magnetic Beads (NEB S1419S) following manufacturer’s protocol ...
-
bioRxiv - Biophysics 2021Quote: ... Fragmented 5’-OH sites were phosphorylated by treatment with 5 units of T4 polynucleotide kinase (NEB) for 1 hour at 37 °C ...
-
bioRxiv - Molecular Biology 2022Quote: ... the DTB-GTP cap was removed leaving a 5’ monophosphate terminus using RNA 5’pyrophophohydrolase (NEB), RNA was bound to AMPure beads and eluted in low TE (10mM Tris pH8.0 ...
-
bioRxiv - Microbiology 2022Quote: ... 2 mM 3’-O-Me-m 7G(5’)ppp(5’)G cap structure analog (NEB S1411S), 0.5 mM GTP ...
-
bioRxiv - Microbiology 2021Quote: ... 5’ triphosphorylated RNA was capped with 3’-desthiobiotin-TEG-guanosine 5’ triphosphate (DTBGTP) (New England Biolabs) using the vaccinia capping enzyme (VCE ...
-
bioRxiv - Cancer Biology 2023Quote: ... Pu TKamplicon (5’-CTGTTTTCATTCTGCCTTTTGACCATAGAGCCCACCGCATCC-3’ and 5’-GCCAACAAAGAAAGCCTCACTACC GGGTAGGGGAGGCG -3) and Gibson Assembly master mix (NEB) following the manufacturer’s guidelines.
-
bioRxiv - Immunology 2022Quote: ... Vκcons 5’GGCTGCAGSTTCAGTGGCAGTGGRTCWGGRAC3’ and Jκ5SHM 5’AGCGAATTCAACTTAGGAGACAAAAGAGAGAAC3’ using Phusion High-Fidelity DNA Polymerase (New Englands Biolabs) and according to following program ...
-
bioRxiv - Microbiology 2024Quote: ... with 5 μl of 5 mM 3’ -desthiobiotin-guanosine triphosphate (DTB-GTP) (NEB product number N0761), 5 μl vaccinia capping enzyme (NEB product number M2080) ...
-
bioRxiv - Biophysics 2024Quote: ... 5 µL 10x T4 RNA ligase buffer and 5 µL T4 ssRNA ligase 1 (NEB, USA) were added and the reaction was incubated for 1 hour at 37°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 µL T4 PNK buffer (NEB), 1 µL SUPER In (Invitrogen) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 5 μL 10X CutSmart buffer (NEB), and 35 μL H2O at 37°C for 16 hours then 80°C for 20 minutes ...
-
bioRxiv - Microbiology 2022Quote: ... and 1 µl 5’deadenylase (NEB) at 30°C for 30 min and removed by RNA Clean & Concentrator (Zymo Research) ...
-
bioRxiv - Biophysics 2022Quote: ... 5 units of Phi29 DNAp (NEB) was loaded in the presence of 20 nM RPA and the specified concentration of dNTPs.
-
bioRxiv - Genomics 2022Quote: ... 5 U of RecBCD (NEB, M0345), 10 μg BSA ...
-
bioRxiv - Genomics 2020Quote: ... 5 μl T4 polynucleotide kinase (NEB), 1 μl T4 DNA Polymerase (NEB ...
-
bioRxiv - Genetics 2020Quote: ... NdeI (NEB, Figure 2 and 5) and SacII (NEB ...
-
bioRxiv - Immunology 2021Quote: ... 5 μL of GC Enhancer (NEB), 5 μL of 5X buffer,10 mM dNTPs ...
-
bioRxiv - Genomics 2021Quote: ... Subsequent 5’ dephosphorylation by CIP (NEB) followed by decapping with RppH (NEB ...
-
bioRxiv - Genetics 2020Quote: ... 5 µL SbfI-HF (NEB R3642L), 50 µL 10x CutSmart NEB buffer ...
-
bioRxiv - Synthetic Biology 2021Quote: ... coli (NEB 5-alpha competent cells), isolated using the Monarch Plasmid preparation kit (NEB ...
-
bioRxiv - Bioengineering 2021Quote: 3 μL of 5′-deadenylase (NEB) were added to ligation reaction,
-
bioRxiv - Genetics 2020Quote: ... and 5 μl CviAII (NEB R0640S). The digestion was performed at room temperature for 2 hours ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 units of Taq polymerase (NEB), and 5 pmoles each of the following primers ...
-
bioRxiv - Genomics 2022Quote: ... 5 U of RecBCD (NEB, M0345), 10 μg BSA ...
-
bioRxiv - Microbiology 2022Quote: ... 5’-phosphorylated with T4 PNK (NEB) and annealed oligonucleotides were used for UP-homology (oBA1761/oBA1762 or oBA1765/oBA1766) ...
-
bioRxiv - Neuroscience 2022Quote: ... Subsequent 5’ dephosphorylation by quickCIP (NEB) followed by decapping with RppH (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... NEB 5-alpha (New England Biolabs), or XL-10 Gold (Agilent ...
-
bioRxiv - Microbiology 2021Quote: ... 5× Phusion HF buffer (NEB, USA), a dNTP nucleotide mix containing 200 μM of each nucleotide (Promega) ...
-
A genome-scale CRISPR interference guide library enables comprehensive phenotypic profiling in yeastbioRxiv - Genomics 2020Quote: ... 5 U lambda exonuclease (NEB M0262S), and 20 U E ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 U of T4 PNK (NEB) were included in the initial NsiI digestion reaction and incubated at 37 °C for one hour.
-
bioRxiv - Molecular Biology 2021Quote: ... 5 μl ExoI buffer (NEB, B0293S), 5 μl CutSmart buffer (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 μl CutSmart buffer (NEB, B7204S), and 30 μl nuclease-free water and incubated for 1 hour at 37 °C and 10 minutes at 80 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNase H (5 U, NEB, M0297S) was added followed by incubation at 37 °C for 20 min and 65 °C for 20 min ...