Labshake search
Citations for New England Biolabs :
151 - 200 of 4511 citations for 8 DECYLOXYPYRENE 1 3 6 TRISULFONIC ACID TRISODIUM SALT since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... Digests with 6 x loading dye (NEB) were run on a 1 % agarose gel at 100 V for 1 h ...
-
bioRxiv - Molecular Biology 2022Quote: ... with 6 μl CutSmart Buffer (NEB, B7204) in a total volume of 60 μl for 3 hours at 37 °C ...
-
bioRxiv - Microbiology 2020Quote: ... and 6 U Bst3.0 DNA polymerase (NEB) in total 15 μl reaction volume ...
-
bioRxiv - Microbiology 2020Quote: ... 6 mM MgSO4 (NEB, final 8mM Mg2+), 1.4 mM each dNTP (Enzynomics) ...
-
A rapid, highly sensitive and open-access SARS-CoV-2 detection assay for laboratory and home testingbioRxiv - Molecular Biology 2021Quote: ... 6 mM MgSO4 (100 mM stock, NEB), 0.32 U/μl NEB Bst 2.0 polymerase ...
-
bioRxiv - Cancer Biology 2021Quote: ... Digest with 6 x loading dye (NEB) was run on a 1 % agarose gel at 100 V for 1 h ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 6 U of Heparinase I (NEB) was added to the first strand cDNA synthesis mix ...
-
bioRxiv - Neuroscience 2021Quote: ... 6 μl BST LF polymerase (NEB M0275L), and 36 μl DEPC-treated H2O ...
-
bioRxiv - Plant Biology 2024Quote: ... 6 µg of the commercial EngenCas9 (NEB) with 2 µg of the freshly synthetized SgRNA1 obtained with the HiScribe™ T7 High Yield RNA Synthesis Kit (NEB) ...
-
bioRxiv - Biochemistry 2023Quote: ... followed by PNGase A (NEB; pH 6). The released N-glycans were purified using initially a cation exchange material (Dowex AG50 H+ form ...
-
bioRxiv - Bioengineering 2024Quote: ... 6 mM Magnesium Sulfate (MgSO4 – NEB #B1003), 1.4 mM deoxynucleotide (dNTP ...
-
bioRxiv - Molecular Biology 2021Quote: ... was resuspended in 10x NEB CutSmart Buffer (8:1) and dephosphorylated by incubation with Quick calf intestinal phosphatase (CIP) (NEB, # M0525S) at 37 °C for 20 min ...
-
bioRxiv - Synthetic Biology 2019Quote: Fly genomic DNA was isolated in a pool by grinding in 25 µl of “Squish Buffer” (10 mM Tris, 1 mM EDTA, 25 mM NaCl, 8 U/ml ProK (NEB P8107S)) per adult ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Systems Biology 2019Quote: ... the Nickel-NTA beads were incubated in 80 μl 3’-linker ligation mix with (1 X PNK buffer, 1 µM 3’-adapter, 10% PEG8000, 30U Truncated T4 RNA ligase 2 K227Q (NEB, M0351L), 60U RNasin) ...
-
bioRxiv - Molecular Biology 2020Quote: ... was linked to the free hydroxyl group at the 3’-end of transcripts (1 □g of total RNA) by T4 RNA ligase 1 (NEB M0204) in the presence of 15% (w/v ...
-
bioRxiv - Genetics 2021Quote: ... EagI/KpnI-digested ORFs were ligated into the EagI/KpnI-digested pUASTattB vector backbone using a 6:1 insert:vector molar ratio and T4 DNA ligase (M0202S, NEB) in a thermocycler overnight (∼16 hr) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and subsequently mixed at a 6:1 ratio with the digested backbone in reactions containing T4 DNA ligase (NEB).
-
bioRxiv - Microbiology 2020Quote: ... 3 mM MgCl2 (NEB), 0.24 mg.ml−1 BSA (Fermentas) ...
-
bioRxiv - Neuroscience 2021Quote: ... and 3 (NEB #E7710) were used to create unique identifiers for each cDNA library sample ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3 µL MNase (NEB) was added to a clarified K562 lysate from ∼5 M cells and digested for 30 minutes at 37 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3’ NotI (NEB) before being tested by sequencing (Macrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... The cDNA coding region corresponding to RDGBPITPd-FFAT (amino acids 1-472) was subcloned into pUAST-attB by using the restriction enzymes NotI and XbaI (NEB). Similarly ...
-
bioRxiv - Microbiology 2022Quote: ... and a subpart of it encoding specifically the PAS domain (amino acids 1-138) the corresponding coding sequence was amplified by PCR using the Phusion DNA polymerase (New England Biolabs) and cloned between the NdeI and BamHI sites ...
-
bioRxiv - Cell Biology 2020Quote: ... A fragment of human Plexin-B1 cDNA (encoding amino acids 1-535) was cloned into the pcDNA5 vector using HindIII (R0104S, NEB) and XhoI (R0146S ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’-hydroxyl (5’HO-RNA30-FAM-3’) or 5’-Gppp (5’Gppp-RNA30-FAM-3’) in 1x NEBuffer 3 (NEB; B7003), in 20% denaturing polyacrylamide gels ...
-
bioRxiv - Developmental Biology 2023Quote: ... rgef-1p and gfp were inserted into a vector containing the sequence rab-7 amplified using PCR and primers 5’-atgtcgggaaccagaaagaa-3’ and 3’-aagcttatcgataccgtcgac-5’ to create rgef-1p::gfp::rab-7::rab-7 3’UTR using Gibson assembly (NEB E2611). A full list of reagents and resources can be found in table S2.
-
bioRxiv - Cancer Biology 2021Quote: ... or a polyclonal rabbit antibody against cleaved casp-3 (1:100; New England Biolabs, Frankfurt, Germany), followed by a biotinylated goat anti-rabbit secondary antibody (Abcam ...
-
bioRxiv - Genomics 2020Quote: ... 1 μL of 10 mM dATP and 15 units of Klenow 3’ → 5’ exo- (NEB M0212L) was added to blunted ends and incubated at 37°C for 30 minutes ...
-
bioRxiv - Microbiology 2019Quote: ... 600 ng of total RNA were mixed with 0.83 μL 100 mM tris pH 7.5 and 0.17 μL 3 mg·mL−1 Random Primers (NEB) to a volume of 5.25 μL ...
-
bioRxiv - Cancer Biology 2020Quote: ... Positive control slides were treated with 3 U/mL DNase-1 (New England Biolabs, Cat. M0303) for 10 minutes at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... Pre-adenylated L3-1R-App 3’ adaptors were ligated using T4 RNA ligase 1 (M0204, NEB) for 75 min at 25°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... and PCR amplified (8-12 cycles) with Phusion polymerase (NEB) using custom primers (22) ...
-
bioRxiv - Biochemistry 2019Quote: ... samples were mixed into an 8%-by-volume Dpn1 (NEB) digestion reaction (37 °C ...
-
bioRxiv - Bioengineering 2021Quote: ... 8 μL of 5X Quick Ligation Reaction buffer (NEB: B6058S), 6 μL of the RMX adapter and 3 μL of T4 DNA ligase (2,000,000 units/mL).
-
bioRxiv - Neuroscience 2020Quote: ... and incubated with 8 μl of T4 Polynucleotide Kinase (NEB) and 2 μl of 10 mM ATP for 30 min at 37 °C ...
-
bioRxiv - Molecular Biology 2021Quote: 8 different polymerases (KAPA HiFi HotStart, Qiagen Taq, Q5 (NEB), Phusion Hot Start Flex DNA Polymerase (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 8 units of Bst 2.0 warmstart DNA polymerase (NEB) followed by incubation at 60°C for 2 minutes to extend the strand with EdUTP-containing DNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... was mixed with 8 mM m7G cap analog (ARCA; NEB), TMG cap analog (Jena Bioscience ...
-
bioRxiv - Biophysics 2023Quote: ... 8 mM ATP and 10 units of T4 ligase (NEB) were incubated overnight at 16°C ...
-
bioRxiv - Genomics 2023Quote: ... (2) +28 μl Dam at 8 U/μl (NEB M0222L); (3 ...
-
bioRxiv - Genomics 2022Quote: ... samples were gently removed from the chamber and digested overnight at 37°C in 8 U mL-1 proteinase K (NEB, cat# P8107) in digestion buffer (1× TAE buffer ...
-
bioRxiv - Neuroscience 2023Quote: ... samples were split into two separate reaction tubes containing 8 μL of PCR product + 1 μL 10X NEB® Buffer #2 (New England Biolabs®). These were incubated in a thermocycler with an initial denaturation of 95 °C for 5 minutes ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plasmid expressing EBFP2-14-3-3 theta was created using HiFi Cloning (NEB) of 14-3-3 theta into pEBFP2-C1 (Addgene plasmid #54665) ...
-
bioRxiv - Immunology 2021Quote: ... 3’ loxP site and 3’ arm of homology) was linearized with NotI (NEB) and recombineered into RP24-227B3 BAC clone that was transformed into SW102 strain by electrophoration (186 ohms ...
-
bioRxiv - Microbiology 2020Quote: ... 6 µg of DNA was used for MmeI digestion in 200 µL (6 µg gDNA, 6 µL MmeI (2000 U/mL, NEB), 0.5 µL 32 mM S-adenosylmethionine ...
-
bioRxiv - Synthetic Biology 2022Quote: ... A fraction (6 μL) of the eluate was mixed with an equal volume of 6× purple gel loading dye (NEB) and loaded in 1% agarose gel with ethidium bromide ...
-
bioRxiv - Immunology 2023Quote: ... was biotinylated with sulfosuccinimidyl-6-[biotinamido]-6-hexanamido hexanoate (sulfo-NHS-LC-LC biotin; ThermoScientific) and coupled to streptavidin beads (New England Biolabs). Patient samples were incubated with RBD-coupled beads and excess sera washed off with PBS (Sigma) ...
-
Direct analysis of ribosome targeting illuminates thousand-fold regulation of translation initiationbioRxiv - Molecular Biology 2020Quote: ... Gel-purified cDNA products were ligated to the adapter oWG920 (Supplementary Table 6) using T4 RNA ligase 1 (NEB M0437M). cDNA cleanup was performed using 10 µl MyOne Silane beads (Thermo Scientific 37002D ...
-
bioRxiv - Synthetic Biology 2020Quote: ... All digested products were column purified and mixed at a 6:1 molar ratio in the presence of T4 DNA ligase (NEB).