Labshake search
Citations for New England Biolabs :
151 - 200 of 5903 citations for 6 Quinolinamine 1 ethyl 1 2 3 4 tetrahydro 2 2 4 trimethyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... α2-3,6,8,9 neuraminidase A (NEB), LB Broth (BD Difco™) ...
-
bioRxiv - Microbiology 2020Quote: ... 2) NEB Q5 (NEB M0491), 3 ...
-
bioRxiv - Molecular Biology 2022Quote: ... T4 RNA ligase 2 (NEB) and RiboLock RNase inhibitor (ThermoFisher Scientific ...
-
bioRxiv - Genomics 2019Quote: ... 2 µL DpnI (NEB # R0176L) is then added and the reaction incubated 1h at 37°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 units DNase I (NEB) or both for 1 hour at 37°C and resolved on a denaturing urea polyacrylamide gel (15% ...
-
bioRxiv - Immunology 2020Quote: ... 2 U DNase I (NEB) was added to IVT mixture and further incubated at 37 °C for 30 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 units DNase I (NEB), or both for 1 h at 37°C and resolved on a denaturing urea polyacrylamide gel (20% ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 μL DpnI (NEB # R0176L) is then added and the reaction incubated 30 min at 37°C ...
-
bioRxiv - Biochemistry 2019Quote: ... 2 U UDG (NEB, M0280S), and 1X UDG buffer (NEB) ...
-
bioRxiv - Microbiology 2021Quote: ... in 1x NEBuffer 2 (NEB) at 37°C for 1 hour ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μl Proteinase K (NEB) was added and samples were incubated at 56°C for 1 hour ...
-
bioRxiv - Biophysics 2022Quote: ... 2 µL factor mix (NEB), 250 nM pre-incubated 50S subunit ...
-
bioRxiv - Plant Biology 2023Quote: ... 2 μL ATP (NEB, B0202S), 2 μL 10X restriction digest buffer (Thermo Scientific ...
-
bioRxiv - Developmental Biology 2023Quote: ... and Set 2 (E7500S, NEB). Quality of the final library preparation was analysed on the Bioanalyzer using the High Sensitivity DNA reagents kit and cassettes (5067-4626 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and set 2 (NEB #7500S) according to the manufacturer’s protocol with minor modifications as noted below ...
-
bioRxiv - Biochemistry 2023Quote: ... and 2 mM ATP) (NEB) at 30 °C for 1 h ...
-
bioRxiv - Immunology 2022Quote: ... with 2 mM MgCl2 (NEB), 0.2mM dNTPs (made in house) ...
-
bioRxiv - Genomics 2024Quote: ... 2 μl of BSA (NEB), 15 μl of dNTPs 10 mM ...
-
bioRxiv - Genomics 2019Quote: ... NEBNext Multiplex Oligos for Illumina (NEB, Set 1; cat. # E7335, NEB, Set 2; cat. # E7500) were used for multiplexing ...
-
bioRxiv - Biochemistry 2020Quote: ... pre-tRNA stock was diluted 1 in 2 into RNA loading buffer (New England Biolabs) and separated on a 10% acrylamide urea-TBE denaturing gel ...
-
bioRxiv - Cancer Biology 2021Quote: ... for 1 h followed by incubating with 2 μL Proteinase K (New England Biolabs, USA) at 65 °C ...
-
bioRxiv - Genomics 2022Quote: ... and NEBNext Multiplex Oligos for Illumina Index Primers Sets 1 and 2 (NEB E7335S & E7500S). In order to increase input DNA above single library limits (1 μg ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR amplified Domain 1 and PCR Domain 2 and HiFi DNA assmbley was performed (NEB). Transformation was performed in DH5α cells (REF) ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA (400ng) was then ligated the 3’adaptor (5’-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3’) using T4 RNA ligase 2(NEB) for 4 h at 37°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA (400ng) was then ligated the 3′adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′) using T4 RNA ligase 2 (NEB) for 4 h at 37°C ...
-
bioRxiv - Genomics 2020Quote: ... add 2 μl 10 mM dATP and 5 μl Klenow Fragment (3’ −> 5’ exo-) (NEB) to digest the unligated DNA fragments at 37°C for 40 min ...
-
bioRxiv - Molecular Biology 2020Quote: 3’ linker ligation (1x PNK buffer, 800 u T4 RNA ligase 2 truncated KQ (NEB), 80 u RNaseOUT ...
-
bioRxiv - Molecular Biology 2023Quote: ... samples were incubated with 1.5 µl EndoH and 2 µl 10× GlycoBuffer 3 (all NEB) buffer at 37°C 1h ...
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were ligated to barcode primers 1-20 of NEBNext Index Primers for Illumina sets 1 and 2 (New England Biolabs) and libraries analysed using DNA High Sensitivity chip on an Agilent 2100 Bioanalyzer before being pooled ...
-
bioRxiv - Biophysics 2023Quote: ... and a reverse elongation primer (Supplementary Tables 1 and 2) and incubating for 1 cycle of annealing/extension with Q5 polymerase (New England Biolabs). dsDNA product was then incubated with ExoSAP-IT (Applied Biosystem ...
-
bioRxiv - Bioengineering 2024Quote: ... containing 0.06 % pluronic acid (F-127, final concentration) and 1 µL of each disulfide bond enhancer 1 and 2 (NEB #E6820). We used droplet oil consisting of 3M™ Novec™ HFE7500 Engineered Fluid (3M ...
-
bioRxiv - Microbiology 2021Quote: ... Index Primers Sets 3 and 4 (New England Biolabs). Libraries were sequenced on an Ilumina NextSeq500 ...
-
bioRxiv - Genetics 2022Quote: ... The resulting monophosphorylated RNAs were ligated to the 3’ adaptor (5’rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’, IDT) using T4 RNA ligase 2 in the presence of 25% PEG8000 (NEB) at 15 °C overnight ...
-
bioRxiv - Cell Biology 2023Quote: ... The small RNAs were then ligated to a 3’ adaptor (5’ rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’; IDT) by T4 RNA ligase 2(NEB). The 5’ adaptor containing 6 nt barcode was ligated using T4 RNA ligase 1 ...
-
bioRxiv - Microbiology 2024Quote: ... Radioactively labelled tRNAs carrying a 2′,3′ cyclic phosphate at the 3′ end was dephosphorylated using T4 polynucleotide kinase (NEB) in 100 mM Tris-HCl pH 6.5 ...
-
bioRxiv - Microbiology 2021Quote: ... For reverse transcription (RT) 1 µg RNA was digested with 2 U of DNase I (NEB). After heat inactivation of the DNase at 70 °C for 5 min ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Ligation was performed by adding 1 unit of T4 RNA Ligase 2 enzyme (New England Biolabs) in 10 μl of 1X reaction buffer and incubating the reaction at 37°C for 60 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... and barcoded using NEBNext Multiplex Oligos for Illumina (Index Primers Set 1 & 2; New England Biolabs). Number of PCR cycles was calculated using a real-time qPCR-based approach (Lion et al. ...
-
bioRxiv - Microbiology 2023Quote: ... 2 µM each of gene- specific forward and reverse primers and 1 unit Phusion polymerase (NEB) were mixed in 1X HF Phusion buffer and 3% (v/v ...
-
bioRxiv - Molecular Biology 2023Quote: ... 200 ng of purified PCR product and 1 µl of NEB 2 Buffer (New England Biolabs) in 9.5 µl total volume were first denatured for 5 min at 95°C and then rehybridized by cooling the sample at a rate of 2°C/s to 85°C and a rate of 0.1°C to 25°C to obtain potential heteroduplex DNA ...
-
bioRxiv - Genetics 2023Quote: ... and NEBNext Multiplex Oligos for Illumina (Index Primers Set 1 and 2; NEB E7335 and E7500). Library DNA was quantified using the Qubit ...
-
bioRxiv - Genomics 2023Quote: 1-2 µg of extracted total RNA and polysomal RNA was treated with DNaseI (NEB, M0303) in a 100 µL reaction at 37 °C for 15 min ...
-
bioRxiv - Genetics 2021Quote: ... 2 × 2 µg of gDNA were digested in parallel with 50 units of DpnII (NEB #R0543L) and NlaIII (NEB #R0125L ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 µl T4 DNA ligase buffer and 2 µl 10 mg/ml BSA (New England Biolabs). These reactions were placed in a thermocycler with following program ...
-
bioRxiv - Microbiology 2022Quote: ... 2 µL NEBNext Bacterial rRNA depletion solution and 2 µL Probe Hybridization Buffer (NEB, CN E7850) were mixed with cells on ice ...
-
bioRxiv - Biochemistry 2020Quote: ... Beads were resuspended in 1 volume of buffer A / 300 mM NaCl / 2 mM MnCl2 / 1 mM DTT and incubated with λ protein phosphatase (NEB) at 50 U / mL for 1 hour at 23°C with agitation ...
-
Striated muscle-specific base editing enables correction of mutations causing dilated cardiomyopathybioRxiv - Genetics 2022Quote: ... RT-PCR or qPCR was performed with 1 μl of 1:2 diluted cDNA using the Q5®Hot Start High-Fidelity 2X Master Mix (NEB) or the SYBR™ Green PCR Master Mix (ThermoFisher) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 mM vanadyl ribonucleoside complex (NEB), 0.02% RNase-free BSA (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 mM Vanadate (Sodium Orthovanadate, NEB, pre-incubated for ten minutes at 95 °C to dissociate Vanadate oligomers ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 μL 10 mM dNTPs (NEB), 9 μL Nuclease-free water ...