Labshake search
Citations for New England Biolabs :
151 - 200 of 4668 citations for 6 Hydroxy 4 trifluoromethyl 2 3' bipyridine 5 carbonitrile since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2019Quote: 5’-Phosphorylated linker (Oligonucleotide K, Supplementary Table 6) was adenylated using a 5’ DNA Adenylation Kit (New England Biolabs) at 20x scale and purified by TRIzol extraction as previously described56 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 µL 10X NEB Buffer #2 (NEB #B7002S), 5 µL RppH (NEB #M0356S) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2-3 ×106 cells were treated with MNase (NEB M0247) ranging from 10-30 Kunitz U in 800 μl of custom buffer (Tris-HCl pH 7.5 10 mM ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5’-triphosporylated RNA was capped with 3’-desthiobiotin-TEG-GTP (NEB)) using the Vaccinia virus Capping enzyme (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... then free 3 adaptors were degraded using 5 deadenylase (NEB, M0331) and RecJf (NEB ...
-
bioRxiv - Immunology 2021Quote: ... and 375 U/mL of Klenow Fragment (3’-5’ exo-) (NEB). After cDNA synthesis and subsequent purification by AMPure XP (Beckman Coulter) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1.5 µ l of Klenow Fragment (3’→5’ exo-, NEB, M0212S) and 1.5 µ l of T4 Polynucleotide Kinase (NEB ...
-
bioRxiv - Genomics 2022Quote: ... and A-tailed using Klenow (3′-5′ exo-; New England Biolabs). Illumina sequencing adapters were then ligated to DNA ends using Quick Ligase (New England Biolabs) ...
-
bioRxiv - Genetics 2019Quote: ... 3 U/µl T4 DNA polymerase (5 µl; New England Biolabs) and nuclease-free water (up to 100 µl) ...
-
bioRxiv - Genomics 2020Quote: ... EcoRI-HF (5’ GAATTC 3’) (New England BioLabs Inc., Ipswich, MA). gDNA samples that showed poor banding patterns or could not be digested by the enzymes listed above were then digested with Taq⍺I (5’ TCGA 3’ ...
-
bioRxiv - Systems Biology 2023Quote: ... and A-tailed using Klenow HC 3’ → 5’ exo (#M0212L; NEB).
-
bioRxiv - Microbiology 2023Quote: ... MBTUni-13 primer (5’-ACGCGTGATCAGTAGAAACAAGG-3’) and Phusion Polymerase (NEB M0530L). PCR products were purified with PureLink PCR Purification Kit (Invitrogen K310002 ...
-
bioRxiv - Genomics 2023Quote: ... and 2.5 U Klenow Fragment (3’ -> 5’ exo-) (New England BioLabs) and H2O to 20 μL ...
-
bioRxiv - Genomics 2021Quote: ... and 4 μl 5 U/μL I-SceI (NEB, #R0694L) in a 50 μL final volume for 3 hours at 37°C ...
-
bioRxiv - Genetics 2023Quote: ... column-purified and transformed in 4 or 5 electroporations (NEB 10-beta Electrocompetent E ...
-
bioRxiv - Microbiology 2019Quote: ... 20 μg of total RNA were ligated with 50 pmol 3′adaptor Linker (5′-rAppCTGTAGGCACCATCAAT–NH2-3′; NEB) through a 16 h incubation at 16°C with 20 U T4 RNA ligase (Ambion) ...
-
bioRxiv - Genomics 2023Quote: ... The hydroxy-methylated DNA fragment was combined with equal amounts of CpG methylated pUC19 DNA (NEB) and unmethylated lambda DNA (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 μL of a mix containing 5 U of T4 RNA Ligase 2 (NEB), 1 mM ATP ...
-
bioRxiv - Genetics 2024Quote: ... m7G(5’)ppp(5’)G RNA Cap Structure Analog (New England Biolabs, 4:1 to GTP) was supplemented to the in vitro transcription reaction ...
-
bioRxiv - Immunology 2021Quote: ... Step 3 was cloned into Step 4 with T4 DNA ligase (NEB) and then this recominbeering fragment (5’ arm of homology ...
-
bioRxiv - Biochemistry 2019Quote: ... A 3’ DNA adapter (CTATAGTGTCACCTAAATTAATACGACTCACTATAGGG) that contains 5’ phosphate and 3’ spacers was first 5’-adenylated using a 5’-adenylation kit (NEB #E2610-S) at 65°C for 1 h ...
-
bioRxiv - Microbiology 2023Quote: ... 6 ng of sample was treated with 2 units T4 Polynucleotide Kinase (NEB) and incubated at 37°C for 30 min ...
-
bioRxiv - Genomics 2019Quote: ... 5 μl of NEB Buffer 2 (New England Biolabs), 2 μl dNTP mix (2.5 mM) ...
-
bioRxiv - Cell Biology 2021Quote: ... resuspended in 5 ml 1x NEB Buffer 2 (NEB) and drop frozen in liquid nitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 μl Thermostable 5’App ligase (New England Biolabs), 4 μl 10 μM pre-adenylated R1R Adapter ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 5’-monophosphate standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with Apyrase (NEB). The 5’-hydroxyl standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with calf intestinal phosphatase (NEB) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 mM of each of the other three dNTPs and 5 U Klenow fragment (3’—>5’ exo-, NEB) in the corresponding buffer ...
-
bioRxiv - Molecular Biology 2019Quote: ... HIS3_hp_For 5′ AAAAGCTTGACCGAGAGCAA and HIS3_hp_Rev 5′ GCGTATTACAAATGAAACCAAGATTCA) and initially cloned into pRS405 (3) between HindIII and XhoI (NEB). A DNA segment containing the GAL1 promoter ...
-
bioRxiv - Molecular Biology 2020Quote: ... Adenosine was added to the 3’ end of the DNA fragments using Klenow (3’-5’ exo-) (New England Biolabs). DNA was purified using ratio of 1:1.8 sample to AMPure XP beads ...
-
bioRxiv - Molecular Biology 2021Quote: ... Adenosine was added to the 3’ end of the DNA fragments using Klenow (3’-5’ exo-) (New England Biolabs). DNA was purified using ratio of 1:1.8 sample to AMPure XP beads ...
-
bioRxiv - Microbiology 2021Quote: ... and a total of 20 μg were ligated with 50 pmol 3′adaptor Linker (5′-rAppCTGTAGGCACCATCAAT–NH2-3′; NEB) via a 16 h incubation at 16°C using 20 U T4 RNA ligase (Ambion) ...
-
bioRxiv - Systems Biology 2021Quote: ... PE2 indexing barcodes were then added by amplifying 2 microliters of the previous reaction with forward primer P1_outer and reverse primers PE2_outer_SIC69 and PE2_outer_SIC70 (Supplementary file 6) for 5 cycles at an annealing temperature of 66C followed by 5 cycles with no annealing step (NEB Q5) and then purified with the Monarch PCR kit.
-
bioRxiv - Systems Biology 2021Quote: ... P1 indexing barcodes were added using forward primers P1_inner_A through P1_inner_D and reverse primer P1_inner_nested_rev (Supplementary file 6) for 5 cycles at an annealing temperature of 55C followed by 5 cycles with no annealing step (NEB Q5). PE2 indexing barcodes were then added by amplifying 2 microliters of the previous reaction with forward primer P1_outer and reverse primers PE2_outer_SIC69 and PE2_outer_SIC70 (Supplementary file 6 ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 µl of 10x NEBuffer 3 (cat#B7003, New England Biolabs), and 13 µl of water were incubated in a thermocycler (cat#EP950040025 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3 mM MgCl2 and 2 μL (10 u) RNase H (NEB) in order to digest poly(A ...
-
bioRxiv - Microbiology 2022Quote: ... 2 µg BSA and 3 units of T4 DNA polymerase (NEB) and incubated at 20 °C for 30 minutes ...
-
bioRxiv - Genomics 2021Quote: ... 2 μL of 10x buffer 4 (New England Biolabs, NEB), 2 μL of 1 mg/ml bovine serum albumin solution (NEB) ...
-
bioRxiv - Genomics 2021Quote: ... 2 μL of 10x buffer 4 (New England Biolabs, NEB), 2 μL of 1 mg/ml bovine serum albumin solution (NEB) ...
-
bioRxiv - Genomics 2020Quote: ... and SalI (5’-GTCGAC-3’, New England Biolabs Inc., MA, CA#R3138S) restriction enzymes ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and A-tailed using Klenow (3′-5′ exo-; New England Biolabs M0212L). Illumina-compatible adapters were subsequently ligated to DNA ends ...
-
bioRxiv - Genomics 2021Quote: ... and A-tailed using Klenow Fragment (3’→5’ exo-) (New England Biolabs) followed by the ligation of NEXTFLEX® Bisulfite-Seq adapters ...
-
bioRxiv - Molecular Biology 2020Quote: ... A mix of 5 μl 3’Ligation Reaction Buffer 2x (NEB-kit) and 1.5 μl of 3’Ligation Enzyme Mix (NEB-kit ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and A-tailed using Klenow Fragment (3’→5’ exo-) (New England Biolabs) followed by the ligation of NEXTFLEX® Bisulfite-Seq Adapters ...
-
bioRxiv - Microbiology 2020Quote: ... which were then degraded by the 5′-3′ ssDNA exonuclease RecJ (NEB). After rRNA depletion using the Ribo-Zero Gold rRNA removal kit (Illumina) ...
-
bioRxiv - Genetics 2022Quote: ... Adenylated 3’ adapter was prepared using the 5’ DNA adenylation kit (NEB) and ligated using T4 RNA ligase 2 ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA fragment overhangs are filled with Klenow Fragment (3’-5’ exo-) (NEB) to leave an A-overhang ...
-
bioRxiv - Molecular Biology 2021Quote: ... Adenylated 3’ adapter was prepared using the 5’ DNA adenylation kit (NEB) and ligated using T4 RNA ligase 2 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Adenylated 3’ adapter was prepared using the 5’ DNA adenylation kit (NEB) and ligated using T4 RNA ligas’ 2 ...
-
bioRxiv - Systems Biology 2023Quote: ... The second strand was synthesized using Klenow Fragment (3’ → 5’ exo-) (NEB). The dsDNA library was digested with Mlul-HF and Pad restriction enzymes (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... and for A-tailing with Klenow Fragment (3’->5’ exo–) (NEB; M0212). A biotinylated primer (ENDseq-adaptor-1 ...