Labshake search
Citations for New England Biolabs :
151 - 200 of 2934 citations for 6 Chloro 7 fluoro 1H indole 2 3 dione since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... A preadenylated DNA adaptor sequence was ligated to the 3’-hydroxyl ends of the RNA fragments using T4 RNA Ligase (T4 RNA Ligase 2, truncated K227Q, NEB #M0351S). The ligated RNA product was reverse transcribed using Superscript III and a barcoded primer with sequence complementarity to the adaptor ...
-
bioRxiv - Molecular Biology 2021Quote: ... Eluted RNA was treated with T4 PNK and preadenylated linker was ligated to the 3’ end using T4 RNA Ligase 2 truncated KQ (NEB, M0373L). Linker-ligated footprints were reverse transcribed using Superscript III (Invitrogen ...
-
bioRxiv - Developmental Biology 2023Quote: ... the tbb-2 3’UTR sequence was amplified from genomic DNA using PCR and primers 5’-tggatgaactatacaaatagatgcaagatcctttcaagca-3’ and 3’-aggttttcaccgtcatcacccgcgaaaaacccatgtaagt-5’ and the vector containing the sequence of pie-1p::his-15::gfp amplified from plasmid containing pie-1p::his-15::gfp::egg-6 3’UTR using PCR and primers 5’-ggtgatgacggtgaaaacct-3’ and 3’-ctatttgtatagttcatccatgcc-5’ were used to generate pie-1p::his-15::gfp::tbb-2 3’UTR by using Gibson assembly (NEB E2611). To add the wild type or mutant 3xmir-51 seed sequences ...
-
bioRxiv - Genomics 2023Quote: ... Eluted RNA was treated with T4 PNK and preadenylated linker was ligated to the 3’ end using T4 RNA Ligase 2 truncated KQ (NEB, M0373L).
-
bioRxiv - Molecular Biology 2023Quote: Internally fluorescein-labelled RNA was produced by ligation of in vitro transcribed 5′ acceptor RNA fragment with chemically produced 3′ donor RNA containing internal fluorescein dT modification and 5′ monophosphate essential for ligase activity using T4 Ligase 2 (NEB #M0239S). Additionally ...
-
bioRxiv - Cell Biology 2024Quote: ... Eluted RNA was treated with T4 PNK and preadenylated linker was ligated to the 3’ end using T4 RNA ligase 2 truncated KQ (NEB, M0373L). Linker-ligated RNA was reverse transcribed with Protoscript II (NEB ...
-
bioRxiv - Genetics 2019Quote: ... in 7 ml of ligation cocktail including 1.1 × ligation buffer (NEB) and 10% Triton X-100 for 2 hours at 16°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 7 units USER Enzyme for 30 minutes at 37°C (NEB)51 ...
-
bioRxiv - Genomics 2021Quote: ... 7 μL 20 μg/μL proteinase K (New England Biolabs P8107) was added ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.1pmol of each fragment were then assembled for 1h at 50°C using NEBuilder HiFi DNA Assembly master mix from the NEBuilder HiFi DNA Assembly Cloning Kit (NEB, ref E5520S). Reaction products were amplified in provided bacteria and purified using QIAprep Spin Miniprep Kit.
-
bioRxiv - Genomics 2019Quote: ... and then cloned into a customized minigene plasmid (a derivative of the pSpliceExpress vector)29 containing an RSV-promoter and two control exons (rat insulin exons 2 and 3) using the NEBuilder® HiFi DNA assembly (NEB, E2621). Amplified fragments were inserted between the two control exons ...
-
bioRxiv - Genomics 2021Quote: The beads were magnetically separated and 4 µl of hot PNK mix (0.2 µl PNK [New England Biolabs], 0.4 µl 32P-γ-ATP, 0.4 µl 10x PNK buffer [New England Biolabs], 3 µl H2O) was added and incubated for 5 min at 37°C in a thermomixer at 1,100 rpm ...
-
bioRxiv - Cell Biology 2024Quote: ... containing a 5′-Biotin-PC group and a 3’-OH (Sup. Table. 2) were ligated to the 5′ end of RNAs using T4 RNA ligase (NEB, Cat #M0204S) for 3 hours at 37°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... Digests with 6 x loading dye (NEB) were run on a 1 % agarose gel at 100 V for 1 h ...
-
bioRxiv - Molecular Biology 2022Quote: ... with 6 μl CutSmart Buffer (NEB, B7204) in a total volume of 60 μl for 3 hours at 37 °C ...
-
bioRxiv - Microbiology 2020Quote: ... and 6 U Bst3.0 DNA polymerase (NEB) in total 15 μl reaction volume ...
-
bioRxiv - Microbiology 2020Quote: ... 6 mM MgSO4 (NEB, final 8mM Mg2+), 1.4 mM each dNTP (Enzynomics) ...
-
A rapid, highly sensitive and open-access SARS-CoV-2 detection assay for laboratory and home testingbioRxiv - Molecular Biology 2021Quote: ... 6 mM MgSO4 (100 mM stock, NEB), 0.32 U/μl NEB Bst 2.0 polymerase ...
-
bioRxiv - Cancer Biology 2021Quote: ... Digest with 6 x loading dye (NEB) was run on a 1 % agarose gel at 100 V for 1 h ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 6 U of Heparinase I (NEB) was added to the first strand cDNA synthesis mix ...
-
bioRxiv - Neuroscience 2021Quote: ... 6 μl BST LF polymerase (NEB M0275L), and 36 μl DEPC-treated H2O ...
-
bioRxiv - Biochemistry 2023Quote: ... followed by PNGase A (NEB; pH 6). The released N-glycans were purified using initially a cation exchange material (Dowex AG50 H+ form ...
-
bioRxiv - Plant Biology 2024Quote: ... 6 µg of the commercial EngenCas9 (NEB) with 2 µg of the freshly synthetized SgRNA1 obtained with the HiScribe™ T7 High Yield RNA Synthesis Kit (NEB) ...
-
bioRxiv - Bioengineering 2024Quote: ... 6 mM Magnesium Sulfate (MgSO4 – NEB #B1003), 1.4 mM deoxynucleotide (dNTP ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Microbiology 2020Quote: ... including equimolar amounts of dGTP and 7-deaza-GTP (New England Biolabs), at a concentration of 200 µM was used (Maertzdorf et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... The solution was diluted by adding 7 ml of ligation buffer (NEB) containing 1% Triton X-100 and 30 Units of T4 DNA ligase (NEB) ...
-
bioRxiv - Biophysics 2022Quote: ... rk430-mScarlet-SNAP (7 μM monomer) was incubated with benzylguanine-biotin (NEB) in a 4 to 1 molar ratio at room temperature for 15 minutes ...
-
bioRxiv - Biochemistry 2021Quote: ... 7 μg pNZdmsC3GH plasmid was digested with 40 U of SfiI (NEB), separated on a 1% agarose gel and ...
-
bioRxiv - Microbiology 2022Quote: ... for 7-12 h at 37°C in CutSmart buffer (NEB, B7204S). Digested products were then visualised on a 4% NuSieve (Lonza ...
-
bioRxiv - Microbiology 2020Quote: ... 3 mM MgCl2 (NEB), 0.24 mg.ml−1 BSA (Fermentas) ...
-
bioRxiv - Neuroscience 2021Quote: ... and 3 (NEB #E7710) were used to create unique identifiers for each cDNA library sample ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3 µL MNase (NEB) was added to a clarified K562 lysate from ∼5 M cells and digested for 30 minutes at 37 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3’ NotI (NEB) before being tested by sequencing (Macrogen ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 1 µl murine RNase inhibitor per sample and 3 µl were added to each sample together with 2 µl truncated T4 polynucleotide kinase (#M0201, NEB; Frankfurt/Main, Germany). Samples were incubated for 2 h at 37°C and the enzyme was deactivated after the reaction by 10 min incubation at 75°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’-hydroxyl (5’HO-RNA30-FAM-3’) or 5’-Gppp (5’Gppp-RNA30-FAM-3’) in 1x NEBuffer 3 (NEB; B7003), in 20% denaturing polyacrylamide gels ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plasmid expressing EBFP2-14-3-3 theta was created using HiFi Cloning (NEB) of 14-3-3 theta into pEBFP2-C1 (Addgene plasmid #54665) ...
-
bioRxiv - Immunology 2021Quote: ... 3’ loxP site and 3’ arm of homology) was linearized with NotI (NEB) and recombineered into RP24-227B3 BAC clone that was transformed into SW102 strain by electrophoration (186 ohms ...
-
bioRxiv - Microbiology 2020Quote: ... 6 µg of DNA was used for MmeI digestion in 200 µL (6 µg gDNA, 6 µL MmeI (2000 U/mL, NEB), 0.5 µL 32 mM S-adenosylmethionine ...
-
bioRxiv - Synthetic Biology 2022Quote: ... A fraction (6 μL) of the eluate was mixed with an equal volume of 6× purple gel loading dye (NEB) and loaded in 1% agarose gel with ethidium bromide ...
-
bioRxiv - Immunology 2023Quote: ... was biotinylated with sulfosuccinimidyl-6-[biotinamido]-6-hexanamido hexanoate (sulfo-NHS-LC-LC biotin; ThermoScientific) and coupled to streptavidin beads (New England Biolabs). Patient samples were incubated with RBD-coupled beads and excess sera washed off with PBS (Sigma) ...
-
bioRxiv - Bioengineering 2019Quote: Purified guide crRNA and template RNA was obtained by following this in vitro transcription as a 100 µL batch reaction with a DNA digestion step (0.035 U/µL DNaseI, 1x DNaseI Buffer, NEB No. M0303S, 37°C, 1h) and a phenol-chloroform extraction protocol in a 5’-Phase Lock Gel Heavy (VWR ...
-
bioRxiv - Systems Biology 2023Quote: ... Signals following a 1h incubation at room temperature with the appropriate HRP-conjugated secondary antibodies (anti-mouse NEB 7076S or anti-rabbit NEB 7074S) were acquired using the Clarity Western ECL Substrate (Bio-Rad ...
-
bioRxiv - Genomics 2019Quote: ... and 6 µL Klenow (5 U/µL, NEB), and DNA blunting was carried out for 1 h at room temperature with shaking at 800 rpm ...
-
bioRxiv - Genomics 2019Quote: ... and 6 μl USER enzyme (New England Biolabs). The reaction was incubated at 37°C for three hours ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 6 μl 10mM ATP (New England Biolabs). Linear DNA was then digested by 30 minute incubation at 37°C ...
-
bioRxiv - Biochemistry 2021Quote: ... and 6 μM of random hexamer primer (NEB). cDNA was amplified with Taq DNA polymerase (NEB ...
-
bioRxiv - Genetics 2020Quote: ... 6 μl 20 mg/ml BSA (NEB B9000S), and 5 μl of 400 U/μl T4 ligase (NEB M0202S/L) ...
-
bioRxiv - Microbiology 2022Quote: ... 6 U Bst 2.0 WarmStart DNA polymerase (NEB), and 2.25 U WarmStart® RTx Reverse Transcriptase (NEB) ...
-
bioRxiv - Microbiology 2022Quote: ... 4 mM MgSO4 (NEB; final, 6 mM Mg2+), 1 mM each dNTP (Enzynomics) ...