Labshake search
Citations for New England Biolabs :
151 - 200 of 2459 citations for 6 CHLORO 3 METHYLPYRIDO 3 4 D PYRIMIDIN 4 3H ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... Then 3 μl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Molecular Biology 2024Quote: ... Then 3 μl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 μl of PvuI (NEB, Cat. R3150S) PacI (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... 10% NEBuffer 3 (New England Biolabs, #B7003S) in a thermocycler at 85°C for 3 min ...
-
bioRxiv - Cell Biology 2023Quote: ... Then 3 µl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Genomics 2023Quote: ... 3 µl of Lambda Exonuclease (NEB, #M0262L), and 3 µl of Exonuclease I (NEB ...
-
bioRxiv - Cancer Biology 2023Quote: ... Then 3 μl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Genomics 2024Quote: ... 3 μl each of HinP1I (NEB R0124S), DdeI (NEB R0175L) ...
-
bioRxiv - Biochemistry 2024Quote: ... Then 3 µL USER Enzyme (NEB, USA) was used with size selected ...
-
bioRxiv - Cancer Biology 2024Quote: ... Then 3 μl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Systems Biology 2024Quote: ... then 3 μL of USER enzyme (NEB) was added and mixed again by pipetting ...
-
bioRxiv - Biochemistry 2020Quote: ... α1- 3,4,6), 10 U β-galactosidase (P0726S, β1-3) and 8 U β-galactosidase (P0746S, β1-3,4) (all from New England BioLabs, USA). All reactions were performed in a final volume of 10 μl in 50 mM sodium acetate buffer ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA (400ng) was then ligated the 3’adaptor (5’-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3’) using T4 RNA ligase 2(NEB) for 4 h at 37°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Adenosine was added to the 3’ end of the DNA fragments using Klenow (3’-5’ exo-) (New England Biolabs). DNA was purified using ratio of 1:1.8 sample to AMPure XP beads ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA (400ng) was then ligated the 3′adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′) using T4 RNA ligase 2 (NEB) for 4 h at 37°C ...
-
bioRxiv - Microbiology 2022Quote: ... and a 956 bp fragment of omp-pst2 gene was amplified using the primers OmpPst2_F4qs (5’-ATTATTCGCGGCGGGTGTTAC-3’) and OmpPst2_R4qs (5’-CAGCGGCCATATTCTTGTTGA-3’) using the Q5 High-Fidelity DNA Polymerase (New England BioLabs). The PCR program consisted in an initial step at 98°C for 5 min ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 1 μl of 10mM dATP and 3 μl of 5 U/μl Klenow fragment 3’ -> 5’ exo- (NEB M0212) in the thermocycler with the following program ...
-
bioRxiv - Microbiology 2022Quote: ... Briefly 5 µg pAc CrPV 5’UTR-1A-GFP-3’ or pCrPV-3 plasmids were linearized with Eco53KI (NEB) or 5 µg pTOPO dsRNA plasmids with EcoR1 (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... Adenosine was added to the 3’ end of the DNA fragments using Klenow (3’-5’ exo-) (New England Biolabs). DNA was purified using ratio of 1:1.8 sample to AMPure XP beads ...
-
bioRxiv - Microbiology 2021Quote: ... and a total of 20 μg were ligated with 50 pmol 3′adaptor Linker (5′-rAppCTGTAGGCACCATCAAT–NH2-3′; NEB) via a 16 h incubation at 16°C using 20 U T4 RNA ligase (Ambion) ...
-
bioRxiv - Microbiology 2021Quote: ... pCMV-hnCoV-S-H501Y-Δ69/70 was obtained from pCMV-7.1-hnCoV-S-H501Y (forward: 5’-TCCGGCACAAACGGCACA-3’, reverse: 5’-GATGGCGTGGAACCATGTC-3’) via Q5 SiteDirected Mutagenesis Kit (NEB). All plasmids were confirmed by gene sequencing (BGI Beijing) ...
-
bioRxiv - Microbiology 2023Quote: ... PM (5’-GACCCCGTTGACAGCG-3’) and PMrev (5’-TGGAACACCTGGCGGAAA-3’) with T4 polynucleotide kinase (0.075 U/µL) (New England Biolabs) and [g32P]-ATP (3000 Ci/mmol ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4 μl of RCA mixture was combined with 4 μl Restriction enzyme buffer (New England Biolabs), 13 μl MilliQ ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 4 U of SssI (NEB) or 4 µl purified Eco72IM (diluted 1:100 ...
-
bioRxiv - Neuroscience 2019Quote: ... in 1X NEBbuffer 4 (NEB #B7004), or an equivalent volume of ultra-pure water and 1X NEBbuffer 4 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 4 U DNase I (NEB) was used for each 200 μl to digest the DNA nanoswitches at 37 °C for 1 hour ...
-
bioRxiv - Bioengineering 2021Quote: ... 4 μl 10mM dNTPs (N0477L, NEB), 1 μl RNase Inhibitor (30281 ...
-
bioRxiv - Genetics 2020Quote: ... 4 μl T4 DNA polymerase (NEB), 1 μl DNA polymerase Klenow (NEB) ...
-
bioRxiv - Genomics 2019Quote: ... 4 μl Klenow fragment (NEB M0212L) and 10 μl 10 nM dATP 20 min at 37 °C and 20 min at 75°C to inactivate the reaction ...
-
bioRxiv - Physiology 2019Quote: ... 4 μl of 10xG7 Buffer (NEB), 4 μl of 10% NP-40 (NEB ...
-
bioRxiv - Pathology 2019Quote: ... 4 U/ml RNase inhibitor (NEB) and proteinase inhibitor cocktail (Roche ...
-
bioRxiv - Biophysics 2019Quote: ... 4 µL Murine RNase inhibitor (NEB), 1 µL T7 polymerase (NEB) ...
-
bioRxiv - Pathology 2020Quote: ... 4 U/ml RNase inhibitor (NEB) and proteinase inhibitor cocktail (Roche ...
-
bioRxiv - Genetics 2020Quote: ... 4 Units of terminal transferase (NEB) were added together with dCTP in a final concentration of 0.1 mM ...
-
bioRxiv - Biochemistry 2021Quote: ... 4 U of Proteinase K (NEB) were added to the reaction and incubation continued for 30 minutes at 37 °C ...
-
bioRxiv - Microbiology 2021Quote: ... 4 mg/ml BSA (NEB B9000S), 300 U/μl RL Lysozyme ...
-
bioRxiv - Microbiology 2020Quote: ... and 4 U/ml apyrase (NEB) were added and the reaction was incubated overnight at room temperature ...
-
bioRxiv - Genomics 2024Quote: ... 4 μl of Inorganic Pyrophosphatase (NEB) and 2 μl of Phi29 DNA Polymerase (NEB) ...
-
bioRxiv - Genomics 2024Quote: ... 0.67x NEB buffer 4 (NEB, B7004S), 0.13% Triton X-100 (sigma ...
-
bioRxiv - Pathology 2021Quote: RT-qPCR was also performed on RNA extracted from the 4 dpi lung samples with NEB Luna Universal One-Step RT-qPCR Kit with SYBR-Green (NEB, Ipswich, MA, USA) to quantify the cytokines IL-6 and IFN-β ...
-
bioRxiv - Cell Biology 2020Quote: ... Renilla luciferase was PCR amplified from pMT-DEST48-FLP 31 with Renilla Luciferase Forward: 5’-TGGAAGCTTGGCATTCCGGTACTGTTGGTAAAGCCACCATGACTTCGAAAGTTTATG-3’ and Renilla Luciferase Reverse: 5’-TGGAAGCTTTTATTATTGTTCATTTTTGAGAAC-3’ and digested with HindIII (NEB). Renilla luciferase was then ligated into pGL3-Control digested HindIII (NEB ...
-
bioRxiv - Immunology 2022Quote: ... and we digested up to 3 μg of DNA with 3 μl of EcoRI-HF restriction enzyme (New England Biolabs) per 50 μl.
-
bioRxiv - Molecular Biology 2021Quote: ... The 3’ adapter (RNA oligo: 5’P-GAUCGUCGGACUGUAGAACUCUGAAC-3’InvdT) was pre-adenylated prior to use (5’ DNA adenylation kit, NEB, according to the manufacturer’s instructions) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Ribodepleted RNA were then ligated to 10 pmol of a biotinylated 3’ adapter, (3’-Adap TAIL-seq, Supplementary Table 7) using 10 units of T4 RNA ligase 1 (NEB) in a final volume of 10 μl for one h at 37°C ...
-
bioRxiv - Cell Biology 2022Quote: ... DNA fragments were end-repaired and T-tailed with Klenow fragment lacking 5’ → 3’ and 3’ → 5’ exonuclease activity (NEB). In-house adapters containing 8-nucleotide unique molecular identifier (UMI ...
-
bioRxiv - Cancer Biology 2019Quote: ... PCR amplification of the target locus (forward primer: 5’-GGTTCTCAGTGCACGCATTT-3’; reverse primer: 5’-ACAACGATTTTCCTGGCATCT-3’) with Q5 polymerase (NEB), and Sanger sequencing of PCR products by the Keck Biotechnology Resource Laboratory at Yale ...
-
bioRxiv - Molecular Biology 2019Quote: ... Fragment ends were repaired using the NEBNext End Repair Module and adenosine was added at the 3’ ends of fragments using Klenow fragment (3’ to 5’ exo minus, New England Biolabs), universal adaptors were ligated to the A-tailed DNA fragments at room temperature for 1 h with T4 DNA ligase (New England Biolabs ...
-
bioRxiv - Genomics 2019Quote: ... fragmented nascent RNA was dissolved in H2O and incubated with 10 pmol of reverse 3’ RNA adaptor (5’p-rNrNrNrNrNrNrGrArUrCrGrUrCrGrGrArCrUrGrUrArGrArArCrUrCrUrGrArArC-/3’InvdT/) and T4 RNA ligase I (NEB) under manufacturer’s conditions for 2 h at 20°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 3’ RNA linker (20 µM) (Dharmacon, 5’-phosphate-AGAUCGGAAGAGCGGUUCAG-3’ was added by T4 RNA Ligase 1 (NEB M0204) at 16°C overnight ...
-
bioRxiv - Systems Biology 2021Quote: ... 1 µL of the boiled colony was used for PCR with primer pair (JGI_27F: 5’-AGAGTTTGATCCTGGCTCAG-3’and JGI_1391R: 5’-GACGGGCRGTGWGTRCA-3’) with NEB Q5 Polymerase (New England Biolabs, Ipswitch, MA). The PCR amplicon was confirmed by agarose gel electrophoresis and the sequence was determined using conventional Sanger Sequencing (Genewiz LLC ...