Labshake search
Citations for New England Biolabs :
151 - 200 of 4857 citations for 5 3 Chloro 4 2 cyclohexylethoxy phenyl methylene 2 4 thiazolidinedione d4 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... and 4 mM SAM (NEB). RNAs were then purified with the RNA Clean and Concentrator-5 Kit (Zymo) ...
-
bioRxiv - Genomics 2023Quote: ... 1.5 μL NEBuffer 4 (NEB), 0.75 μL T4 Phage β-glucosyltransferase (NEB M0357S) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 4 mM dNTPs (NEB #N0447L), 250 nM PAGE-purified forward and reverse primers ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4 U Turbo DNase (NEB) and 3 U FastAP enzyme (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2021Quote: The beads were magnetically separated and resuspended in 20 µl of 3’ end RNA dephosphorylation mixture (4 µl 5x PNK pH 6.5 buffer, 0.5 µl PNK [New England Biolabs; with 3’ phosphatase activity] ...
-
bioRxiv - Physiology 2021Quote: ... 5’ end repair was done using T4 PNK with 2 mM ATP (NEB P0756S). Following RNA purification with Zymo Oligo Clean & Concentrator (D4060) ...
-
bioRxiv - Developmental Biology 2023Quote: ... On-Bead 5’ Decapping reaction was done using NEBuffer 2 buffer (NEB, B7002S ®). Off-Bead Reverse Transcription followed the instructions in SuperScript ® IV Reverse transcriptase kit ...
-
bioRxiv - Microbiology 2022Quote: ... a custom 3’ adapter (5’-rAppCTGTAGGCACCATCAAT–NH2-3’, NEB, S1315S) was ligated to all RNAs ...
-
bioRxiv - Systems Biology 2021Quote: ... the purified DNAs were annealed using random nonamer primers with a 5′-biotin tag (5′-Biotin-CTACACGACGCTCTTCCGATCTNNNNNNNNN-3′) in the presence of Klenow fragments (3′-5′ exo-, New England Biolabs). Then ...
-
Differential impact of a dyskeratosis congenita mutation in TPP1 on mouse hematopoiesis and germlinebioRxiv - Cell Biology 2021Quote: ... 5′ 32P-labeled (TTAGGG)4 oligonucleotide (labeled using [γ-32P]ATP and T4 PNK; New England Biolabs) was added ...
-
bioRxiv - Cancer Biology 2023Quote: ... Nuclei were centrifuged (500xg, 5 min, 4°C) and washed once with 1X NEBuffer 2.1 (NEB, #B7202). For nucleosome depletion ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Nuclei were pelleted at 500 ξ g at 4°C for 5 minutes and resuspended in 0.5 mL of 1.2x NEBuffer r2.1 (New England Biolabs) containing 3% sodium dodecyl sulfate (SDS ...
-
bioRxiv - Neuroscience 2021Quote: ... 2 (NEB #E7500) and 3 (NEB #E7710 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Pu TKamplicon (5’-CTGTTTTCATTCTGCCTTTTGACCATAGAGCCCACCGCATCC-3’ and 5’-GCCAACAAAGAAAGCCTCACTACC GGGTAGGGGAGGCG -3) and Gibson Assembly master mix (NEB) following the manufacturer’s guidelines.
-
bioRxiv - Molecular Biology 2020Quote: ... Products were then ligated to 3’ adaptor (/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/) by T4 RNA ligase 2(NEB) and 5’ adaptor (rGrUrUrCrArGrArGrUrUrCrUrArCrArGrUrCrCr-GrArCrGrArUrCrNrNrNrCrGrArNrNrNrUrArCrNrNrN ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Vcan exon 2 and exon 3 were amplified using Phusion Taq (NEB, catalog no. F530L) (see SI) ...
-
bioRxiv - Developmental Biology 2022Quote: ... and ligated to the 3′ adapter by incubating with T4 RNA ligase 2 truncated mutant (NEB) and 1 µg of pre-adenylated adapter (5′rAppCTGTAGGCACCATCAAT/3ddc ...
-
bioRxiv - Biochemistry 2023Quote: ... The tRNA 2’-3’ cyclic phosphate was removed by treatment with T4 PNK (New England Biolabs) following the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2024Quote: ... the RNA was ligated to the 3′ adaptor tRNA using T4 RNA ligase 2 (NEB, M0351L) for 2 h at 37°C ...
-
bioRxiv - Bioengineering 2021Quote: 3 μL of 5′-deadenylase (NEB) were added to ligation reaction,
-
bioRxiv - Genomics 2023Quote: ... Klenow Fragment (3’→5’ exo-) (NEB) was diluted in 1X NEBuffer 2 to a final concentration of 2 U/μL ...
-
bioRxiv - Cell Biology 2021Quote: ... and DNA fragments were amplified by PCR with NEXTFlex primers (Primer 1 - 5’-AATGATACGGCGACCACCGAGATCTACAC; Primer 2 - 5’-CAAGCAGAAGACGGCATACGAGAT) and Phusion High-Fidelity DNA Polymerase (NEB) and further purified with AMPure XP beads to eliminate unligated primers and adapters ...
-
bioRxiv - Cell Biology 2021Quote: ... Libraries were amplified by PCR using NextFlex PCR primers (Primer 1 - 5’-AATGATACGGCGACCACCGAGATCTACAC; Primer 2 - 5’-CAAGCAGAAGACGGCATACGAGAT) and Phusion High-Fidelity DNA Polymerase (NEB) before three further rounds of AMPure XP purification were performed to collect fragments 150-300 bp in size ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 uL aliquots were removed at each time point and added to 2 uL 5 mg/mL Proteinase K (NEB) in 5% SDS ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4 μl of RCA mixture was combined with 4 μl Restriction enzyme buffer (New England Biolabs), 13 μl MilliQ ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 units of Klenow Fragment (3’à 5’ exo-, NEB), CutSmart buffer (NEB) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 µl of Klenow Fragment (3′→5′ exo-, NEB, M0212S), 3 µl of T4 polynucleotide kinase (NEB ...
-
An alternatively spliced TREM2 isoform lacking the ligand binding domain is expressed in human brainbioRxiv - Molecular Biology 2022Quote: The cDNA samples from the anterior cingulate samples were amplified using primers corresponding to TREM2 exon 1 (5’-CCTGACATGCCTGATCCTCT-3’) and exon 5 (5’-GTGTTCTTACCACCTCCCC-3’) with Q5 high-fidelity hot-start polymerase (NEB # M0493L). Thermocylcing parameters were as follows ...
-
bioRxiv - Cancer Biology 2024Quote: ... After signal detection membranes were stripped and re-hybridized overnight at 50 °C with oligonucleotides detecting β-actin (5’-GTGAGGATCTTCATGAGGTAGTCAGTCAGGT-3’) and U6 (5’-GGAACGCTTCACGAATTTGCGT-3’) 5’-end labeled with T4 polynucleotide kinase (New England Biolabs) and [γ-32P]ATP ...
-
bioRxiv - Genomics 2020Quote: ... 5 μL of Phusion High Fidelity 2× Master mix (New England Biolabs, Beverly MA, USA) and 2 μL of 10 μM standard Illumina P1 and P2 primers ...
-
bioRxiv - Microbiology 2020Quote: ... DNA was removed by adding 2 μL DNaseI and 5 μL 10x DNase buffer (NEB) to the purified RNA and incubated at 37C for 30 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 4 U DNase I (NEB) was used for each 200 μl to digest the DNA nanoswitches at 37 °C for 1 hour ...
-
bioRxiv - Bioengineering 2021Quote: ... 4 μl 10mM dNTPs (N0477L, NEB), 1 μl RNase Inhibitor (30281 ...
-
bioRxiv - Genetics 2020Quote: ... 4 μl T4 DNA polymerase (NEB), 1 μl DNA polymerase Klenow (NEB) ...
-
bioRxiv - Pathology 2020Quote: ... 4 U/ml RNase inhibitor (NEB) and proteinase inhibitor cocktail (Roche ...
-
bioRxiv - Genetics 2020Quote: ... 4 Units of terminal transferase (NEB) were added together with dCTP in a final concentration of 0.1 mM ...
-
bioRxiv - Biochemistry 2021Quote: ... 4 U of Proteinase K (NEB) were added to the reaction and incubation continued for 30 minutes at 37 °C ...
-
bioRxiv - Microbiology 2021Quote: ... 4 mg/ml BSA (NEB B9000S), 300 U/μl RL Lysozyme ...
-
bioRxiv - Microbiology 2020Quote: ... and 4 U/ml apyrase (NEB) were added and the reaction was incubated overnight at room temperature ...
-
bioRxiv - Genomics 2024Quote: ... 4 μl of Inorganic Pyrophosphatase (NEB) and 2 μl of Phi29 DNA Polymerase (NEB) ...
-
bioRxiv - Genomics 2024Quote: ... 0.67x NEB buffer 4 (NEB, B7004S), 0.13% Triton X-100 (sigma ...
-
bioRxiv - Biophysics 2024Quote: ... 4 U Murine Rnase Inhibitor (NEB), 5 mM EDTA ...
-
bioRxiv - Biochemistry 2024Quote: ... 4 μL T7 polymerase (NEB #M0251S), 24 μL template DNA (adjusted to 0.3 μM) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 2′ O-methylated using Vaccinia VP39 (2′ O Methyltransferase) (NEB) in a reaction that also included 1X capping buffer (NEB) ...
-
bioRxiv - Cancer Biology 2021Quote: ... ΔN1/2/3 and ΔDAD mutants were generated by Q5® Site-Directed Mutagenesis Kit (NEB, E0554S) with HOXB13 WT or NCOR1 WT as a template ...
-
bioRxiv - Immunology 2020Quote: ... (2) and (3) was synthesized through HiScribe™ T7 ARCA mRNA Kit (with tailing) (New England Biolabs). All the mRNA products were concentrated and purified via EZ-10 Spin Column RNA Cleanup & Concentration Kit (Bio Basic Inc.) ...
-
bioRxiv - Molecular Biology 2022Quote: 3’ linker ligation (1x PNK buffer, 800 U T4 RNA ligase 2 truncated KQ (NEB, Cat#M0373L), 80 U RNaseOUT ...
-
Atypical epigenetic and small RNA control of transposons in clonally reproducing Spirodela polyrhizabioRxiv - Plant Biology 2024Quote: ... were ligated to 3′ barcoded DNA adapters using truncated T4 RNA ligase 2 (New England Biolabs, #M0373). These fragments were separated in an 12% denaturing polyacrylamide-urea gel ...
-
bioRxiv - Genomics 2024Quote: ... along with a 4.8uL 3:2 master mix of T4 ligase buffer:T4 ligase (New England Biosciences, NEB) and 9.4uL of nuclei buffer with BSA (NBB ...
-
bioRxiv - Microbiology 2023Quote: ... 1 μl of RNase inhibitor and 3 μl of T4 RNA ligase 2 (truncated) (New England Biolabs) were added and mix well by pipetting ...