Labshake search
Citations for New England Biolabs :
151 - 200 of 7197 citations for 2 1 ethylpentyl 1 3 dioxan 5 yl laurate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... 3 µl freshly made 1 M NH4HCO3 and calf intestinal alkaline phosphatase (1 U, New England Biolabs) were added ...
-
bioRxiv - Molecular Biology 2024Quote: ... Antibodies: Rabbit anti-Yap1 (Cat# 14074S; 1:300) and Rabbit anti-Smad2/3 (NEB #8685S; 1:300).
-
bioRxiv - Microbiology 2021Quote: ... 5 μl of 10 mM MnCl2 and 1-2 μl (400-800 units) of λ PP (New England Biolabs, Ipswich, MA). Untreated lysates received 1-2 μl of water in place of λ PP ...
-
bioRxiv - Physiology 2024Quote: ... the following reagents were added to each tube containing 1 cell in ∼5 μL: 2 μL M-MuLV Reverse Transcriptase Reaction Buffer (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were fixed in 1:3 glacial acetic acid:methanol (Biolabs-chemicals) solution and the G-banding karyotype was determined ...
-
bioRxiv - Molecular Biology 2024Quote: ... steps 1–3: GELase was replaced by β-agarase I (NEB). The reaction (1 U per plug ...
-
bioRxiv - Microbiology 2020Quote: ... Genomic DNA was PCR amplified using primers: 5’-gaagaaatgaatttgccagg-3’ and 5’-ctcatgttcttcttgggc-3’ and Phusion DNA Polymerase Master mix (New England Biolabs, Ipswich, MA). DNA was sent for Sanger Sequencing to check for reversion mutations.
-
bioRxiv - Plant Biology 2022Quote: The pVecBar-Rht13 construct contained a 6,998 bp fragment including 2,532 bp upstream and 450 bp downstream regions amplified from Magnif mutant genomic DNA using primers Rht13-NotF2 (5’ AATGCGGCCGCAATCGATAGGAGAGCTGCGTCTGTGTG 3’) and Rht13-AscR2 (5’ TGCGTACGGCGCGCCGAGAGTCGCCTTGCCAGTTC 3’) with Phusion® High-Fidelity DNA Polymerase (NEB, USA). pVecBarIII is a derivative of pWBvec8 (Wang et al. ...
-
bioRxiv - Genetics 2023Quote: The yeast plasmids recovered after thermoselection were subject to a shortened PCR with 15 cycles with oligonucleotide pairs oWS1408 (5°-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCAGCATATAATCCCTGCTTTA-3°) and oWS1409 (5°-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGTCCAGGGGTGGTGCAAACTATG-3°) using a high-fidelity Q5 polymerase (New England Biolabs, Ipswich, MA) to attach overhang sequences ...
-
bioRxiv - Biochemistry 2023Quote: ... and “frq segment 4F” (5’-CACCGATCTTTCAGGAGACCCTG-3’) and “frq segment 4R” (5’-CACTCAGGTC TCAATGGTGA TG-3’) pair with pCB05 digested with FseI (NEB, Catalog # R0588S) and MluI (NEB ...
-
bioRxiv - Biochemistry 2023Quote: ... “frq segment 3F” (5’-GTCGCACTGGTAACAACACCTC-3’) and “frq segment 3R” (5’-CAGCACATGTTCAACTTCATCAC-3’) were designed for pCB05 digested with NruI (NEB, Catalog # R0192S) and FseI (NEB ...
-
bioRxiv - Microbiology 2024Quote: ... The variable region V3+V4 of the 16S rRNA gene was amplified using a broad-range primer pair (338F: 5’-ACTCCTACGGGAGGCAGCA-3′, 806R:5′-GGACTACHVGGGTWTCTAAT-3′) using the Phusionâ High-Fidelity PCR Master Mix (New England Biolabs, Beverley, MA). The PCR amplification program was as follows ...
-
bioRxiv - Molecular Biology 2024Quote: ... The library was amplified in triplicate PCR reactions using oligonucleotides corresponding to the Illumina sequence adaptors (5’-AATGATACGGCGACCACCGAGATCTACAC-3’ and 5’-CAAGCAGAAGACGGCATACGAGAT-3’) and Phusion DNA polymerase (New England Biolabs, cat. M0531) for 11 cycles ...
-
bioRxiv - Biophysics 2024Quote: ... The PDZ and Protease domain of HtrA1 were amplified using primers 5’-ATCACCAAGAAGAAGTATATTG-3’ and 5’-GGATCCTTTTTCGAACTGC-3’ as well as 5’-TAGCTCGAGCACCACCAC-3’ and 5’-TTTGGCCTGTCGGTCATG-3’with a NEB Q5® Site-Directed Mutagenesis Kit (New England Biolabs, MA). The mutation of S328A of HtrA1 and its Protease domain were created using primers 5’-CTATGGAAACgcgGGAGGCCCGT-3’ and 5’-TTGATGATGGCGTCGGTCTG-3’ with a NEB Q5® Site-Directed Mutagenesis Kit (New England Biolabs ...
-
bioRxiv - Biophysics 2024Quote: ... The mutation of S328A of HtrA1 and its Protease domain were created using primers 5’-CTATGGAAACgcgGGAGGCCCGT-3’ and 5’-TTGATGATGGCGTCGGTCTG-3’ with a NEB Q5® Site-Directed Mutagenesis Kit (New England Biolabs, MA). The PCR protocol was as followed ...
-
bioRxiv - Molecular Biology 2023Quote: Internally fluorescein-labelled RNA was produced by ligation of in vitro transcribed 5′ acceptor RNA fragment with chemically produced 3′ donor RNA containing internal fluorescein dT modification and 5′ monophosphate essential for ligase activity using T4 Ligase 2 (NEB #M0239S). Additionally ...
-
bioRxiv - Developmental Biology 2023Quote: ... the tbb-2 3’UTR sequence was amplified from genomic DNA using PCR and primers 5’-tggatgaactatacaaatagatgcaagatcctttcaagca-3’ and 3’-aggttttcaccgtcatcacccgcgaaaaacccatgtaagt-5’ and the vector containing the sequence of pie-1p::his-15::gfp amplified from plasmid containing pie-1p::his-15::gfp::egg-6 3’UTR using PCR and primers 5’-ggtgatgacggtgaaaacct-3’ and 3’-ctatttgtatagttcatccatgcc-5’ were used to generate pie-1p::his-15::gfp::tbb-2 3’UTR by using Gibson assembly (NEB E2611). To add the wild type or mutant 3xmir-51 seed sequences ...
-
bioRxiv - Cell Biology 2024Quote: ... were then ligated to pre-annealed Nano-tRNAseq 5’ and 3’ RNA adapters at room temperature for 2 hours with 20% PEG PEG 8000 (NEB, B10048) using recombinant E ...
-
bioRxiv - Genomics 2023Quote: ... 5 μL of Digestion-2 mix (NdeI (5 U, NEB, R0111L) and/or BglII (5 U ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 1.5 μl Klenow Fragment (3’->5’ exo-) (NEB, cat#M0212S, 5 U/μl) per amplicon pool reaction ...
-
bioRxiv - Molecular Biology 2020Quote: ... by Klenow fragment (3’→5’ exo-) (NEB, Ipswich, MA) for 30 min at 37 °C ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 0.15 U Klenow Fragment (3’→5’ exo-) (NEB) in 1X NEBuffer 2 at 37°C for 30 minutes (cite) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 5μL Klenow Fragment (3′->5′ exo-, NEB, N0202S) for A-tailing were added at 37°C for 40 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: ... A-tailed with Klenow 3’ to 5’ exo-(NEB), ligated to Illumina Truseq LT adaptors using Quick Ligase enzyme (NEB ...
-
bioRxiv - Genetics 2020Quote: ... 3 μL 5× Phusion HF buffer (New England Biolabs), 2.7 μL dH2O ...
-
bioRxiv - Genomics 2022Quote: ... A-tailed with Klenow 3’ to 5’ exo-(NEB), ligated to Illumina Truseq LT adaptors using Quick Ligase enzyme (NEB ...
-
bioRxiv - Cancer Biology 2023Quote: ... NU-1611-Cy3),1.5ul of Klenow Fragment (3’→5′ exo-, NEB, M0212S) and 1.5ul of T4 Polynucleotide Kinase (NEB ...
-
bioRxiv - Genomics 2020Quote: ... A-tailing 3’ end was performed using Klenow Fragment (3’→5’ exo-) (New England Biolabs), and then TruSeq Adapters were ligated by Quick T4 DNA Ligase (New England Biolabs) ...
-
bioRxiv - Developmental Biology 2020Quote: ... followed by addition of 3’-A overhangs using Klenow Fragment 3’-5’ exo- (NEB, M0212S). After denaturation of DNA at 95°C for 3 min ...
-
bioRxiv - Cell Biology 2021Quote: ... A-tailing 3’ end was performed using Klenow Fragment (3’→5’ exo-) (New England Biolabs), and then TruSeq Adapters were ligated by Quick T4 DNA Ligase (New England Biolabs) ...
-
bioRxiv - Genomics 2020Quote: ... before and in between the following procedures: (1) 3′ adapter ligation with T4 RNA Ligase 1 (NEB, M0204L), (2 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 μl 10 pM/μl TrAEL-seq adaptor 1 and 1 μl T4 RNA ligase 2 truncated KQ (NEB M0373L). Plugs were then rinsed with 1 ml tris buffer ...
-
bioRxiv - Plant Biology 2023Quote: ... The up- and downstream flanks were obtained by PCR on gDNA of IPO323 with primer pairs 1&2 and 5&6 (Table S7) respectively using Q5 Hot Start High fidelity DNA polymerase (NEB, Evry, France). The hph was amplified from pCAMBIA0380 with the primers 3 and 4 (Table S7) ...
-
bioRxiv - Genomics 2020Quote: ... 1 µl T4 RNA Ligase 2 truncated (200U; NEB)] was added ...
-
bioRxiv - Biochemistry 2021Quote: ... disulfide bonding enhancer 1 and 2 (New England BioLabs), RNase inhibitor (Takara Bio Inc. ...
-
bioRxiv - Genomics 2021Quote: ... or 2 mU DNase 1 (Cat. No. M0303S; NEB) and 0 ...
-
bioRxiv - Neuroscience 2020Quote: ... with TdTomato was amplified by PCR with primers (5’- ggcgcgCCCCCCTCTCCCTCCCCCCC -3’ and 5’- ggcgcgccTTACTTGTACAGCTCGTCCATGCCGTACAG -3’) using Hot start Q5® polymerase (NEB, Frankfurt, Germany) from LeGO-iT (a gift from Boris Fehse ...
-
bioRxiv - Plant Biology 2022Quote: ... 250 μL 2× lysis buffer (20 mM Tris-HCl, 40 mM Na2EDTA, 1% (w/v) SDS) and 3 μL proteinase K (NEB: P8102S, 20 mg/mL) were added and incubated under agitation at 55°C for 2 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μl 1M MgCl2 and 2 μl of 1 U/μl Xrn1 (M0338, NEB) were added after RNase H digest ...
-
bioRxiv - Genomics 2020Quote: ... 5′ adapter ligation with T4 RNA Ligase 1 (NEB, M0204L). The resulting RNA fragments were used for a reverse transcription reaction using Superscript III Reverse Transcriptase (Life Technologies ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 1 μl of 5 units/µl RNase H (NEB) were added and samples were incubated at 37°C for 30 minutes ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 µL RNase H enzyme (5 U) (New England Biolabs) was added and the solution was incubated at 44°C for 1 hr ...
-
bioRxiv - Plant Biology 2023Quote: ... 1 μL of PaqCI/AarI activator (5 pmol, NEB, S0532S), 1 μL of 10 U PaqCI/AarI (NEB ...
-
bioRxiv - Genomics 2023Quote: ... 5 μL of rSAP mix (rSAP (1 U, NEB, M0371L) in 1X CutSmart buffer (for MseI/NdeI digestions ...
-
bioRxiv - Systems Biology 2024Quote: ... 1 μL of Klenow DNA Polymerase (5 U/μL, NEB) and 2 μL of T4 PNK (10 U/μL ...
-
bioRxiv - Genomics 2024Quote: ... 1 μL BST DNA Polymerase FL (NEB, 5 U/µL), 2μL TAQ Ligase (NEB ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 μl H2O and 1 μl PNGase F (NEB, P0704S) were then added to the lysate ...
-
bioRxiv - Genomics 2024Quote: ... 5 µL dNTP mix (NEB, 2 mM), 1 µL MgSO4 (100 mM) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 µL ligation mix (2 µL 10x T4 ligase buffer, NEB, 1 µL T4 RNA ligase 2, truncated, NEB, 1 µL Ribolock inhibitor) was added and incubated (1 h ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 μl 10 pM/μl TrAEL-seq adaptor 1 (49) and 1 μl T4 RNA ligase 2 truncated KQ (NEB M0373L). Plugs were then rinsed with 1 ml tris buffer ...