Labshake search
Citations for New England Biolabs :
1901 - 1950 of 10000+ citations for Glutathione Fluorescent Detection Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... The NEB HiFi assembly kit (New England Biolabs) was used to clone the gene fragment into a pET29b expression vector ...
-
bioRxiv - Synthetic Biology 2024Quote: ... using Phusion© High-Fidelity PCR Kit (NEB) with annealing temperature at 62 ◦C ...
-
bioRxiv - Microbiology 2024Quote: ... The Q5 NEB Mutagenesis Kit (New England Biolabs) was used to add an NES (LQKKLEELEL ...
-
bioRxiv - Microbiology 2024Quote: ... the Q5 Site-Directed Mutagenesis Kit from NEB was used according to the protocol and mutagenesis primers were designed using NEBaseChanger.
-
bioRxiv - Microbiology 2020Quote: ... and a “bottom” strand with sequence 5’-AAAAC-(30bp spacer reverse complement)-3’ were phosphorylated with PNK (NEB, M0201S) in a 50 μL reaction volume (1.5 μL 100 uM top oligo ...
-
bioRxiv - Genetics 2021Quote: ... Tagmented library was amplified with P5_BRB and BRB_Idx7N5 primers (5 μL, Supplementary Table 14) using NEBNext UltraTM II Q5 Master Mix (NEB, M0544L) which was incubated at 98 °C for 30 sec before adding DNA with the following conditions ...
-
bioRxiv - Genetics 2021Quote: ... and 420μl H2O with 1 hr incubation at room temperature and then subjected to proximity ligation by adding 200μl 5× ligation buffer (B6058S, NEB), 6μl biotinylated bridge linker (200ng/ul) ...
-
bioRxiv - Microbiology 2021Quote: ... 5 mM MgCl2, 10% Glycerol, 0.05% NP-40, 2 mM DTT, 10 mM Ribonucleoside-Vanadyl complex [New England Biolabs, MA USA] ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA (400ng) was then ligated the 3’adaptor (5’-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3’) using T4 RNA ligase 2(NEB) for 4 h at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... at 50°C for 60 min with a subsequent Klenow DNA polymerase step using 5 units (New England Biolabs) at 37°C for 60 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... Adenosine was added to the 3’ end of the DNA fragments using Klenow (3’-5’ exo-) (New England Biolabs). DNA was purified using ratio of 1:1.8 sample to AMPure XP beads ...
-
bioRxiv - Molecular Biology 2021Quote: The RNA primer was labelled at the 5’ terminus with [γ-32P]ATP using T4 PNK (New England Biolabs) and PAGE purified ...
-
bioRxiv - Molecular Biology 2021Quote: ... eight rounds of linear amplification PCR reactions with 40μg genomic DNA were performed with 5 μg genomic DNA each using HS Flex polymerase (NEB) and biotinylated Myc primer (Table S2) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 µl of 10x RNase H reaction buffer and 1 µl (5 units) of RNase H (New England Biolabs) were added to 8 µl of the reaction mixture and incubation was continued for another 30 min ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5 µl 10 x dNTPs with dUTP instead of dTTP (2 mM each) and 1 µl T4 polymerase (NEB) were added and the mixture was incubated at 37°C in a thermal cycler for 20 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA (400ng) was then ligated the 3′adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′) using T4 RNA ligase 2 (NEB) for 4 h at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... The immunoprecipitated RNA was 5’-end-labeled with 32P using T4 polynucleotide kinase (New England Biolabs catalogue number M0201L), separated using 4–12% BisTris-PAGE ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and 5 µl of CutSmart buffer and 2 µl of EcoRI-HF® (New England Biolabs, catalog no. R3101) were added before incubation for 6 h at 37°C ...
-
bioRxiv - Biochemistry 2020Quote: ... were radiolabeled at the 5’-end with 32P using the manufacturer recommended protocol for T4 PNK (New England Biolabs) and ATP [g-32P] (Perkin Elmer) ...
-
bioRxiv - Biochemistry 2020Quote: ... Approximately 5 μg of each PcCel6A mutant gene in pPICZα was linearized by restriction enzyme PmeI (New England Biolabs) for the transformation of P ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 5’ end of the digested RNA is then labelled with 10 U T4 PNK (New England Biolabs M0201) and 10 µCi [γ-32P]ATP (Perkin Elmer BLU002Z250UC ...
-
bioRxiv - Plant Biology 2021Quote: ... Digested DNA was ligated during 5 h incubation at 16 °C with 100 U of T4 DNA ligase (NEB). DNA was recovered after reverse crosslinking and Proteinase K treatment (Invitrogen ...
-
bioRxiv - Neuroscience 2020Quote: ... The holder allowed immersion of the cochlea and the middle ear in oxygenated (95 % O2, 5 % CO2) cell culture medium (Minimum Essential Medium with Earle’s balanced salts, SH30244.FS Nordic Biolabs). The bone of the bulla was removed gently with bone cutters which exposed the middle ear and the basal turn of the cochlea ...
-
bioRxiv - Biochemistry 2021Quote: ... 2.5 μl of reaction was added to a tube containing 5 μl replication buffer and 1 μl MseI (NEB) for 3 min ...
-
bioRxiv - Plant Biology 2020Quote: ... 5 μg of total RNA was purified using the Poly(A) mRNA Magnetic Isolation Module (New England Biolabs, Massachusetts). Libraries were constructed using the ULTRA II directional library kit (New England Biolab ...
-
bioRxiv - Molecular Biology 2021Quote: ... The pellet was resuspended in 18.5 μL T4 DNA Ligase Reaction Buffer with 5 μL of 10 μM annealed Broken end linker and 1.5 μL T4 DNA Ligase (#M0202S, New England Biolabs). The reaction was incubated 18-20 h at 16°C with constant mixing ...
-
bioRxiv - Cancer Biology 2021Quote: ... We performed 5 or 20 Gibson assembly reactions for tiling or genome-wide sgRNA library followed by manufacturer’s instructions (NEB) and purified DNA using ethanol precipitation ...
-
bioRxiv - Biochemistry 2022Quote: ... Reactions contained approximately 5 μL of isothermal assembly mix (prepared similar to as previously described12) or NEBuilder HiFi (NEB), 0.01 pmol of plasmid linearized via SpRYgest ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 5’ end of the first block and the 3’ end of the last block contained SapI (NEB, R0569) recognition sites instead ...
-
bioRxiv - Genomics 2022Quote: ... Cells were fixed with 3% paraformaldehyde in PBS for 10 min at room temperature and permeabilized for 5 min on ice in PBS containing 0.5%Triton X-100 and 2mM Vanadylribonucleoside complex (New England Biolabs). Coverslips were preserved in 70% EtOH at -20°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5’end of RNA was phosphorylated and labelled by γ-[32P] ATP using T4 Polynucleotide Kinase (New England Biolabs) at 37°C for 45 min ...
-
bioRxiv - Molecular Biology 2019Quote: ... Ncas_Int679_For 5′ GGCAAATTTGTATGAGGGATAAA and Ncas_Int679_Rev 5′ TAATTCGATTACGTTAGCTGTT) and cloned into pRS403-pGAL1-hpSC_URA3 (1) using PsiI and NaeI restriction enzymes (New England Biolabs, NEB). In addition ...
-
bioRxiv - Molecular Biology 2020Quote: ... Beads were then washed once in 5 volumes of binding buffer (100μL, 1xPBS containing 1mg/mL of BSA (NEB)) for 10 minutes at RT ...
-
bioRxiv - Cell Biology 2021Quote: ... COS-7 cell lysates from FLAG-ACBD4(wACBD5_FFAT)/5 (mFFAT) expressing cells were treated for 1 h with λPP (New England BioLabs) as described above ...
-
bioRxiv - Cancer Biology 2020Quote: ... pre-existing histones were first quenched by incubating cells with 5 µM SNAP-cell Block (New England Biolabs; S9106S) for 30 min at 37 °C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Selectively captured polyadenylated RNAs (1μg) were ligated directly to an DNA/RNA hybrid adapter (5’-CTACAC GACGCTrCrUrUrCrCrGrArUrCrUrNrNrN-3’) using T4 RNA ligase (NEB) at 37°C for 30 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... or RCC970 in 50 μl total volume containing 5 μl 10x Q5 Reaction Buffer (NEB, Frankfurt am Main, Germany), 0.5 U of Q5 High-Fidelity DNA Polymerase (NEB) ...
-
bioRxiv - Biochemistry 2020Quote: Every single stranded oligonucleotide (1 nmol) was 5’-end-phosphorylated with 40U of T4 Polynucleotide kinase (New England Biolabs) by incubation at 37°C in 1x T4 DNA Ligase Reaction Buffer.
-
bioRxiv - Biochemistry 2020Quote: ... 14 nucleotides in length (TIBMOL BIOL, Berlin) were radioactively phosphorylated with [32γP] dATP at their 5’ ends using phosphokinase (NEB) following the manufacturer protocol and used as a length standards.
-
bioRxiv - Molecular Biology 2022Quote: ... Up to 5 μg of gDNA was digested with 15 U of SalI-HF® enzyme (NEB, Cat# R3138L) for 3 hr at 37°C and separated on 0.9% agarose gel for 16 hr at 50 V ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The total volume reaction was 25 μl with the following composition: 5 μL 10× buffer at 1.0 mM (New England BioLabs), 0.1 mM each dNTP ...
-
bioRxiv - Biochemistry 2019Quote: ... All sens RNA strands were labeled at their 5’ end with [γ-32P] ATP using protein nucleotide kinase (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... was hybridized to the 3’ adapter and the 5’ adapter ligated by adding 2μL T4 RNA ligase buffer (NEB), 5μL PEG 8000 (NEB) ...
-
bioRxiv - Bioengineering 2019Quote: ... The PCR product was inserted into pcDNA3.1 via 5’EcoRI/3’NotI restriction digestion and a standard ligation protocol (T4 DNA Ligase; New England BioLabs) to create pcDNA3.1-Ncadherin ...
-
bioRxiv - Genetics 2020Quote: ... the beads were resuspended in 75 μL of ChIP Dilution Buffer and 5 μL of BSA (New England BioLabs) and incubated at 4°C overnight with rotation for blocking ...
-
bioRxiv - Microbiology 2020Quote: ... and the 5’ ends of the DNA (25 nM) were radiolabeled using T4 polynucleotide kinase (PNK, New England Biolabs). Excess ...
-
bioRxiv - Microbiology 2020Quote: ... 0.5 μM of each forward and reverse primer (Supplementary Table 1) and 2.5 U Long Amp Taq Polymerase (NEB) in a total volume of 25 μL ...
-
bioRxiv - Microbiology 2021Quote: ... DNA oligonucleotides (Supplementary Table 2) were radiolabeled at the 5’ end by T4 Polynucleotide kinase (PNK) (New England Biolabs) treatment and [γ-32P] (PerkinElmer ...
-
bioRxiv - Bioengineering 2019Quote: The pcDNA 3.1 NCadTS expression construct was generated using overlap extension PCR [5] using Phusion Polymerase (New England BioLabs). The forward and reverse primers 5’ CCA CAG TAC CCA GTC CGA TCC GCA GCC ATG GTG AGC AAG GGC GAG GAG ACC ACA ATG GGC 3’ ...
-
bioRxiv - Genomics 2021Quote: ... Ligation was done overnight at 16°C also rotating at 900rpm for 10 seconds every 5 minutes by adding 120μl of 10X ligation buffer (NEB), 664μl water ...