Labshake search
Citations for New England Biolabs :
1901 - 1950 of 6510 citations for 6 Chloro 2 4 chlorophenyl N N dimethylimidazo 1 2 α pyridine 3 methanamine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... The digested vector was combined with the amplified inserts in a 5:2 ratio by mass and ligated using a 2X Gibson Assembly Master Mix (NEB) at 50 °C for 30 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... and PCR amplified for 7-9 cycles depending on the samples using NEBNext High Fidelity 2× PCR master mix (New England Biolabs). The optimal cycle number was determined empirically each time by qPCR ...
-
bioRxiv - Genomics 2023Quote: ... were PCR-amplified (2 PCR reactions, 12 cycles) using Illumina adapter-specific primers and NEBNext Ultra II Q5 Master Mix (NEB). After library profile analysis by Agilent 2100 Bioanalyser (Agilent Technologies ...
-
bioRxiv - Plant Biology 2023Quote: ... and amplified using NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs Set 2, New England Biolabs, #E6442). After quality check with the Bioanalyzer High Sensitivity DNA assay (Agilent) ...
-
bioRxiv - Microbiology 2023Quote: ... The reaction mix (2 μL) was then used to transform 25 μL of chemically competent 10-beta cells (C3019H; NEB), which were subsequently plated on Luria-Bertani (LB ...
-
bioRxiv - Molecular Biology 2023Quote: ... was isolated from total RNA or crude cell lysates by 2 rounds of affinity chromatography using oligo d(T)25-derivatized magnetic beads (NEB). RNA yields were quantified by ultraviolet (UV ...
-
bioRxiv - Molecular Biology 2023Quote: Total SNAP-tagged histones were labeled by incubating cells with 2 µM of the red-fluorescent reagent SNAP-cell TMR-star (New England Biolabs) for 15 min before cell fixation ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were generated by 7-9 rounds of PCR amplification using NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L), purified using SPRIselect reagent kit (Beckman Coulter ...
-
bioRxiv - Biochemistry 2023Quote: ... Reactions with UDP-MurNAc-80mer RNA contained 2 µg RNA and products were purified using the Monarch RNA Cleanup Kit (NEB).
-
bioRxiv - Genetics 2023Quote: ... we treated the glands with 0.1% Triton X-100 for 2 minutes prior to adding 100 ug/mL RNase A (NEB #T3018L) and performed a 1 hour incubation at RT (24 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Samples were treated with DNase I (20 units) in the presence of RNase inhibitor at 300 U/ml in x1 buffer # 2 (NEB) at 37°C for 30 min ...
-
bioRxiv - Systems Biology 2023Quote: ... 25 mg of small RNA from the 12 diverse organs/tissues was resuspended in 10 mL of 1x GlycoBuffer 2 (NEB) and 7.5 mL PNGaseF (NEB) ...
-
bioRxiv - Cell Biology 2023Quote: ... Cell pellets were lysed directly in 8X the cell pellet volume with 2% SDS blue loading buffer (New England Biolabs), containing DTT ...
-
bioRxiv - Molecular Biology 2023Quote: ChIP-seq libraries were prepared with 2 ng of input or IP DNA using the NEBNext Ultra II DNA Library kit for Illumina (New England Biolabs). The quality of the libraries was assessed using the High Sensitivity DNA kit (Agilent ...
-
bioRxiv - Molecular Biology 2023Quote: ... sgRNA amplicons were generated by PCR of 2 ug genomic DNA per 100 ul reaction with Q5 2X Hot Start Master Mix (M0494L, NEB) and enough reactions to maintain 1000x screening sgRNA representation ...
-
bioRxiv - Molecular Biology 2023Quote: ... The cosmids were then digested for 2 hours at 37°C and heat-inactivated for 20 minutes at 80°C using SpeI-HF (New England Biolabs). Next ...
-
bioRxiv - Neuroscience 2023Quote: ... They were inserted into the linearized vector of pRVΔG-4mCherry from step 2 described above using HiFi DNA Assembly (NEB, USA). The HiFi reaction was mixed as described below:
-
bioRxiv - Genomics 2023Quote: ... followed by digestion to ribonucleotides by incubation for 2 h at 45 °C with 0.15 U of Nuclease P1 (NEB M0660S) in 10 mM ammonium acetate pH 5 ...
-
bioRxiv - Molecular Biology 2023Quote: The miRCat-33 3’ linker was ligated to the 3’ end of the RNAs on the Ni-NTA beads with 800 units of T4 RNA ligase 2 truncated K227Q (New England Biolabs) in 1 x PNK buffer / 16.67% PEG 8000 in the presence of 80 units RNasin in a total volume of 80 µl ...
-
bioRxiv - Genomics 2023Quote: ... mRNA was eluted from the oligo-dT beads and fragmented by incubating with the First Strand Synthesis Reaction buffer and Random Primer Mix (2×) from the NEBNext Ultra II Directional Library Prep Kit for Illumina (#NEBE7760; New England Biolabs) for 15Lmin at 94°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... was digested with BbsI enzyme and pre-annealed 5’-end phosphorylated sgDNA sequences (found in Extended file 2) inserted using Quick Ligase (New England Biolabs), and subsequently transformed into Stabl3 TM E ...
-
bioRxiv - Developmental Biology 2023Quote: ... 50 nM of RCA primer, 1U/µL of RiboProtect (Blirt, #RT35) and 0.5 U/ µL of T4 RNA Ligase 2 (NEB, # M0239L). The ligation mix was introduced to the SecureSeal chamber and incubated on the samples for 2 hours at 37 degrees Celsius ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 µL i7 unique index primer (10 µM) and 25 µL NEBNext® High-Fidelity 2X PCR Master Mix (NEB) and subjected to the following PCR program ...
-
bioRxiv - Cell Biology 2024Quote: ... Size-selected DNA fragments were amplified using NEB unique multiplexed i5 and i7 primers (E6440) in a total reaction volume of 100 µl together with 2 U Phusion High-Fidelity DNA Polymerase (NEB) and in the presence of 0.2 mM dNTPs and 1X Phusion High-Fidelity buffer ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA of 2×106 cells was extracted with the Monarch Total RNA Miniprep Kit with “on column” DNase I treatment (NEB). cDNA was generated by using LunaScript RT SuperMix Kit (NEB ...
-
bioRxiv - Cancer Biology 2024Quote: ... then split in 2 for PCR amplifications with either Minus or Plus primers using Q5 DNA Polymerase (New England Biolabs) with the following cycling conditions ...
-
bioRxiv - Molecular Biology 2024Quote: ... The ends of DNA were repaired by incubating in 70 μL of 1X NEBuffer 2 containing 0.6 units of T4 DNA polymerase (NEB, M0203S), 2 units of T4 polynucleotide kinase (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... or 2μg (dual-guide) per well were set up using the Q5 Hot Start High-Fidelity 2× Master Mix (NEB #M0494) in a total volume of 50μl ...
-
bioRxiv - Immunology 2024Quote: ... and this point mutation introduces a premature stop codon and abolishes an Hpy118I site and the line was genotyped by PCR (primers in Table 2) and Hpy118I digest (NEB) (Supp Fig 1B) ...
-
bioRxiv - Immunology 2024Quote: ... The irf8 st95 mutation abolishes an AvaI restriction site and this line was genotyped by PCR (primers in Table 2) and AvaI digest (NEB), as previously described (Shiau et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... The homology-directed repair (HDR) plasmid for C-terminal SAX-2::GFP(ju1831) was made using three-fragment Gibson Assembly (New England Biolabs) in which two sax-2 homology arms containing 498 bp upstream of the sax-2 TAA stop codon and 540 bp downstream of the sax-2 TAA stop codon plus the stop codon were amplified from N2 genomic DNA and fused such that they flanked GFP (pDD282) ...
-
bioRxiv - Microbiology 2024Quote: ... Diluted supernatants were used as the template DNA (5 μL) for qPCR using a 2×Luna universal qPCR master mix (New England BioLabs), with 0.5 μM of primers ...
-
bioRxiv - Biochemistry 2024Quote: ... The cDNA was diluted 1:50 in ddH2O and 2 µL used as a template in a 15 µL reaction using the Luna Universal qPCR Master Mix (NEB) on a Rotor-Gene Q (Qiagen) ...
-
bioRxiv - Microbiology 2024Quote: ... followed by excision and ligation for 2 hours at room temperature using the Instant Sticky-end Ligase Master Mix (NEB) in accordance with the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... The NEBuilder Assembly Tool was used to design primers for amplification of each component of the donor plasmid (Table 2) using Phusion (NEB); purified PCR products were assembled using NEBuilder HiFi DNA Assembly Master Mix (NEB) ...
-
bioRxiv - Microbiology 2024Quote: ... The SARS-CoV-2 Spike coding region was then amplified using Q Hot Start High-Fidelity DNA Polymerase (New England Biolabs) with forward (5’ TCATCGATGCATGGTACGCCACCATGTTTGTTTTTCTTGTTTTATTG 3’ ...
-
bioRxiv - Microbiology 2024Quote: ... the RNA pellet was resuspended in 50 µl of RNase-free H2O and 1 µl of the resuspended samples was used for quantification of the DENV-2 D220 NS5 RNA regions using Luna Universal One-Step RT-qPCR Kit (New England Biolabs) in a 10-ul reaction volume ...
-
bioRxiv - Molecular Biology 2024Quote: ... Deletion constructs were made by PCR amplification of the appropriate regions and cloned into the Cilantro 2 vector using Gibson cloning (New England Biolabs). Lentiviral particles carrying the respective constructs in the Cilantro 2 vector were produced and used to transduce MOLM-13 cells as described above ...
-
bioRxiv - Biochemistry 2024Quote: ... pETDuet-1 vector was linearized by digestion with PacI and NdeI and gene fragments were inserted into multiple cloning site 2 (MCS2) of the linearized plasmid via Gibson assembly using the New England BioLabs (NEB) Gibson Assembly Master Mix and following the manufacturer’s standard protocol ...
-
bioRxiv - Genomics 2024Quote: ... with a final extension of 72 °C for 2 minutes using Q5 Hot Start High-Fidelity DNA Polymerase (NEB M0493L). We used 7 cycles for all amplicons ...
-
bioRxiv - Plant Biology 2024Quote: ... To obtain CRISPR-Cas9 mutant alleles of RELK1 one guide RNA specific for exon 2 was cloned into pBUE411 by HiFi cloning (NEB). The resulting construct was introduced into Hi-II immature embryos by Agrobacterium-mediated transformation ...
-
bioRxiv - Plant Biology 2024Quote: To obtain CRISPR-Cas9 mutant alleles of RELK2 and RELK3 a dual targeting guide RNA specific for exon 2 was cloned into pBUE411 by HiFi cloning (NEB). To obtain CRISPR-Cas9 mutant alleles of RELK1 one guide RNA specific for exon 2 was cloned into pBUE411 by HiFi cloning (NEB) ...
-
bioRxiv - Genomics 2024Quote: ... crRNAs were amplified from genomic DNA (primer sequences can be found in (Supp. Table 2) using Q5 2x Master Mix (NEB) in 100 μL reactions with the following thermal cycling parameters:
-
bioRxiv - Microbiology 2024Quote: ... was amplified using primers OVL7966 and OVL6481 and the PCR product was excised from a 2% agarose gel using the Monarch DNA cleanup and gel extraction kit (NEB). One-step Golden Gate Assembly (GGA ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and 0.2 μl 50x oligos of the AarI recognition site for Level 0 and Level 2 cloning or Eco31I/BsaI-HFv2 (ThermoFisher/NEB) for Level 1 cloning ...
-
bioRxiv - Plant Biology 2021Quote: ... and cloned into Gateway™ pENTR™ 4 by mixing the linearized vector backbone and PCR product in a 1:1 ratio using Gibson assembly (NEB), before transformation into DH10B electro-competent E ...
-
bioRxiv - Systems Biology 2021Quote: Rho libraries were amplified using primers MO574 and MO575 (Supplementary file 6) for 6 cycles at an annealing temperature of 66C followed by 18 cycles with no annealing step (NEB Phusion) and then purified with the Monarch PCR kit (NEB) ...
-
bioRxiv - Biophysics 2021Quote: ... and 3 samples from each replicate combined into 7 mL with 1 × T4 DNA Ligase Buffer (NEB), with 1% Triton X-100 ...
-
bioRxiv - Genomics 2019Quote: ... Ligation was performed at a 1:3 ratio of pJDrcEPP:library using T4 DNA ligase (New England Biolabs). Ligation product was cleaned-up using a Clean and Concentrator Kit (Zymo Research ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 uL RNase A and 1 uL ProtK all from the Monarch gDNA extraction kit (NEB, T3010). gDNA was extracted following the extraction kit’s protocol with the exception that 600 uL of gDNA binding buffer were added to 400 uL quenched reaction and added to the extraction column on two spins of 2 minutes at 1000g ...