Labshake search
Citations for New England Biolabs :
1901 - 1950 of 2058 citations for 5 Alpha dihydroprogesterone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... The reaction underwent ethanol precipitation as described above and the precipitated DNA was suspended in 32 μl Elution buffer and used in a 50 μl A-tailing reaction using Klenow (3’→5’ exo-) (NEB, M0212), incubated at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... pH 8.0 and adding 2ul/5-10mg dry weight (DW) of PNGaseF (Peptide-N-Glycosidase F) (New England Biolabs, Cat. #P0704S). Samples were incubated with continuous agitation at 150 rpm (Stuart Horizontal Shaker ...
-
bioRxiv - Genomics 2022Quote: ... 1500 calcein-stained cells in 5 μL of were added to 35 μL of barcoded hydrogel templates with 29 U/mL Proteinase K (NEB #P8107S) and 70 mM DTT (Sigma #D9779 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 5’ ends of RNA fragments were phosphorylated by T4 PNK and ligated to 5’ adaptor (CGATCTCCAATTCCCACTCCTTTCAAGACCTrC) using T4 RNA Ligase 1 (NEB, M0437M). Ribosomal RNA (rRNA ...
-
bioRxiv - Biochemistry 2024Quote: ... 13 nt long RNA was radiolabelled at the 5’-end with [γ-32P] ATP and T4 Polynucleotide kinase (New England Biolabs) prior to complexes assembly ...
-
bioRxiv - Biochemistry 2024Quote: ... A 13 nt RNA oligonucleotide was radiolabeled at the 5’ end with [γ-32P] ATP and T4 polynucleotide kinase (New England Biolabs) prior to EC assembly ...
-
bioRxiv - Bioengineering 2024Quote: ... The splitGFP plasmid was amplified using primers 53 and 54 to install 3’ stop codon and primers 55 and 56 to install the 5’ stop codon using Q5® High-Fidelity DNA Polymerase (New England Biolabs) for 35-cycles ...
-
bioRxiv - Molecular Biology 2023Quote: Internally fluorescein-labelled RNA was produced by ligation of in vitro transcribed 5′ acceptor RNA fragment with chemically produced 3′ donor RNA containing internal fluorescein dT modification and 5′ monophosphate essential for ligase activity using T4 Ligase 2 (NEB #M0239S). Additionally ...
-
bioRxiv - Immunology 2024Quote: ... Insert and vector were combined at a 5:1 ratio and held at 50 °C for 1 hour in NEBuilder® HiFi DNA Assembly Master Mix (NEB). Gibson assembly products were purified using the MinElute® PCR Purification Kit (Qiagen) ...
-
bioRxiv - Neuroscience 2024Quote: ... A 5’-adenylated DNA adapter (5’-rAppAGATCGGAAGAGCACACGTCT-NH2-3’) was added to 3’-ends using truncated T4 RNA ligase 2 (New England Biolabs; M0242S). After ligation of the 5’-RNA adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC-3’ ...
-
bioRxiv - Molecular Biology 2023Quote: ... The tube containing the plugs was then cooled to 42°C before adding 5 µl of Beta-Agarase I (New England Biolabs, M0392) and incubating at 42°C for 1 hour ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The mixture was then returned to ice for 5 minutes before 180 μL of NEB® 10-beta/Stable Outgrowth Medium (B9035, NEB) was added ...
-
bioRxiv - Genomics 2023Quote: ... The pellet was resuspended in 90 µL of freshly prepared Micro-C “Master Mix 1” (10 μl 10x T4 DNA Ligase Buffer, 75 μl ddH2O, 5 μl T4 PNK (NEB #M0201L)) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 3.3 kb DNA sequence upstream of each respective gene was amplified using PCR and cloned into the vector containing the sequence gfp::rab-7::rab-7 3’UTR amplified from plasmid rgef-1p::gfp::rab-7::rab-7 3’UTR using PCR and primers 5’-atgagtaaaggagaagaacttttca-3’ and 3’-aagcttatcgataccgtcgac-5’ were used to generate tissue-specific gfp::rab-7::rab-7 3’UTR by using Gibson assembly (NEB E2611).
-
bioRxiv - Developmental Biology 2023Quote: ... the pre- microRNA sequence of mir-51 was amplified from genomic DNA using PCR and primers 5’-cggcatcgacgacgacgacggtccgaaaagtccgtctacc-3’ and 3’- cagttggaattctacgaatgaactgtattgctgctgggc-5’ and the vector containing the sequence of rgef-1p and unc-54 3’UTR amplified from plasmid rgef-1p::aak-2::unc-54 3’UTR using PCR and primers 5’-cattcgtagaattccaactgagc-3’ and 3’-cgtcgtcgtcgtcgatgc-5’ were used to generate rgef-1p::mir-51::unc-54 3’UTR by using Gibson assembly (NEB E2611).
-
bioRxiv - Developmental Biology 2023Quote: ... rgef-1p and gfp were inserted into a vector containing the sequence rab-7 amplified using PCR and primers 5’-atgtcgggaaccagaaagaa-3’ and 3’-aagcttatcgataccgtcgac-5’ to create rgef-1p::gfp::rab-7::rab-7 3’UTR using Gibson assembly (NEB E2611). A full list of reagents and resources can be found in table S2.
-
bioRxiv - Developmental Biology 2023Quote: ... the tbb-2 3’UTR sequence was amplified from genomic DNA using PCR and primers 5’-tggatgaactatacaaatagatgcaagatcctttcaagca-3’ and 3’-aggttttcaccgtcatcacccgcgaaaaacccatgtaagt-5’ and the vector containing the sequence of pie-1p::his-15::gfp amplified from plasmid containing pie-1p::his-15::gfp::egg-6 3’UTR using PCR and primers 5’-ggtgatgacggtgaaaacct-3’ and 3’-ctatttgtatagttcatccatgcc-5’ were used to generate pie-1p::his-15::gfp::tbb-2 3’UTR by using Gibson assembly (NEB E2611). To add the wild type or mutant 3xmir-51 seed sequences ...
-
bioRxiv - Genetics 2023Quote: ... 600 ng linearized plasmid backbone and 48 ng of digested library (molar ratio of 1:3) were ligated with 5 μL (2000 U) of T4 DNA ligase (NEB M0202S) in a 100 μL reaction ...
-
bioRxiv - Developmental Biology 2023Quote: ... the coding sequence of alg-1 was amplified from genomic DNA using PCR and primers 5’- acaaggacgacgacgacaagatggaagaccaatggttgct-3’ and 3’- cagttggaattctacgaatgttaagcaaagtacatgacgttgttggc-5’ and the coding sequence of mKate::3xFLAG was amplified from a plasmid containing mKate::3xFLAG using PCR and primers 5’-cggcatcgacgacgacgacgatggtttccgagttgatcaagg-3’ and 3’- cttgtcgtcgtcgtccttgtagtcgatAtcgtggtccttgtagtcaccgtcgtggtccttgtagtccttacgatgtccgagcttgg-5’ and the vector containing rgef-1p and unc-54 3’UTR was amplified from plasmid rgef-1p::aak-2::unc-54 3’UTR using PCR and primers 5’-cattcgtagaattccaactgagc-3’ and 3’-cgtcgtcgtcgtcgatgc-5’ were used to generate rgef-1p::mKate::3xFLAG::alg-1 by using Gibson assembly (NEB E2611). To generate a DNA plasmid containing rgef-1p::mKate::3xFLAG::alg-2 ...
-
bioRxiv - Plant Biology 2023Quote: ... 500 ng of RCA amplicons were treated with T7 endonuclease 5 μL of 10× reaction buffer and 1 μL of T7 endonuclease I (New England Biolabs, M0302S) in a 50 μL reaction volume ...
-
bioRxiv - Molecular Biology 2023Quote: ... Unligated 3’ linker was removed by incubating the samples with the 5’-deadenylase KmHnt3 (see Recombinant protein expression and purification) and RecJ exonuclease (New England Biolabs, M0264S) for 45 min at 37 °C ...
-
bioRxiv - Systems Biology 2024Quote: ... The resulting full-length cDNA was gel-purified and ligated to the 5′ adaptor OWG920 with High Concentration T4 RNA Ligase (NEB M0437M) overnight on a shaking thermomixer ...
-
bioRxiv - Systems Biology 2024Quote: ... 3 µl of 100 µM barcode-linked oligo-dT primer was added to each well with 5 µl of 5x ProtoScript RT buffer (New England Biolabs M0368). The plate was incubated at 94°C for 2 min and immediately cooled on ice for at least 5 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... Transposed DNA was then purified on Diapure columns (Diagenode, Transposed purified DNA was then pre-amplified for 5 PCR Cycles using NEBNext High-Fidelity PCR MasterMix (NEB, M0541) and Illumina indexing primers ...
-
bioRxiv - Immunology 2023Quote: ... The digested and purified inset and vector were ligated at a ratio of 5:1 using T4 DNA ligase (NEB, M0202) overnight at 18°C ...
-
bioRxiv - Genomics 2023Quote: ... Libraries were constructed using the NEBNext Ultra II directional RNA library preparation kit for Illumina according to the protocol for purified mRNA or ribosome-depleted RNA and with a 5-min RNA fragmentation step (NEB E7760). Library PCRs were supplemented with 2× SYBR dye (Sigma S9430 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 5 μL of PCR product was added to a 10 μL reaction containing 0.2 μL DraI (New England BioLabs, MA, USA) and 1 μL rCutSmart™ Buffer (New England BioLabs ...
-
bioRxiv - Genomics 2024Quote: ... Prior to library preparation a UDG-treatment was performed using 16.25ul of purified DNA and 5 μl (1U/1uL) USER enzyme (New England BioLabs®, Inc.) and an incubation of 3 hours at 37°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... The regulatory sequences of Crbn were PCR amplified from genomic DNA (primers in Supp Table 5) and cloned into a pCESA vector upstream of H2BGFP coding sequences using the restriction enzymes AscI and NotI (NEB England). Mutations into the Snail binding motif of the Crbn regulatory sequences were obtained by recombination using NEBuilder (NEB England ...
-
bioRxiv - Developmental Biology 2022Quote: ... the cells were washed 3 times with PBS and permeabilized 5 min on ice with permeabilize sol (1xPBS, 1%RNAse inhibitor Ribovanadylcomplex (RVC, NEB,#S1402S), 0,5 % Triton X-100 (Sigma ...
-
bioRxiv - Molecular Biology 2022Quote: ... 15 pmol dephosphorylated RNA was 5’ phosphorylated with 32P from γ-32P ATP (Hartmann Analytic) with T4 PNK (New England Biolabs) in 1x PNK buffer in a 20 μl reaction ...
-
bioRxiv - Molecular Biology 2022Quote: ... Toe-printing reactions were carried out in 5-µl aliquots containing a PURExpress transcription-translation coupled system (New England Biolabs, USA) to which the test template was added (16) ...
-
bioRxiv - Bioengineering 2022Quote: ... 1X of a restriction enzyme mix [1/2 EcoRI-HF® (NEB #R3101, 2/5 Nuclease-free water, 1/10 CutSmart Buffer 10X (NEB)] ...
-
bioRxiv - Genomics 2022Quote: ... 10 U of the enzyme was used in the 50 μl-reaction containing 5 μl of rCutSmart Buffer (10X, NEB # B6004S) for 30 min-incubation at 37°C ...
-
bioRxiv - Genomics 2022Quote: ... blunt DNA fragments on the beads were adenine-tailed by adding 7μl of Klenow 3’→5’ exo-polymerase 5U/μl (New England Biolabs cat. #M0212L), 2.3μl of dATP 10mM and 5 μl NEB2 of 10x NEBuffer 2 and incubating the mixture 30 minutes at 37ºC and a further 10 minutes at 65ºC to inactivate the enzyme.
-
bioRxiv - Genetics 2022Quote: ... ds-DNA was constructed from two oligos that are annealed and 5’ overhangs filled in using Klenow polymerase according the manufacture’s specifications (NEB cat. M0210L). All yeast transformation were carried out using the lithiumacetate method ...
-
bioRxiv - Plant Biology 2022Quote: ... followed by treatment with DNase I.5 The samples were then purified with the Monarch® RNA Cleanup Kit (New England Biolabs).
-
bioRxiv - Molecular Biology 2023Quote: ... Beads were next resuspended in 1X Thermo Pol Buffer and treated with 2 µL RNA 5’ Pyrophosphohydrolase (New England Biolabs M0356) at 37°C for 1 h to promote decapping of 5’ RNA ends ...
-
bioRxiv - Genomics 2022Quote: ... PCR amplification was carried out by addition of 5 µL 10 µM Nextera index mix(Vazyme, #TD203) and 25 µL Q5 High-Fidelity 2X master mix (NEB, #M0492S) to the 20 µL sample ...
-
bioRxiv - Microbiology 2022Quote: ... The resulting double-stranded oligos had 5’ extensions that were complementary to the non-palindromic 3’ overhangs generated by BsaI-HFv2 (NEB, R3733) digestion of pJJW101 ...
-
bioRxiv - Biochemistry 2023Quote: ... The total RNA was treated by DNase I (5 U per 100 μg total RNA) and mRNAs were enriched by NEBNext Poly(A) mRNA magnetic isolation module (NEB E7490L). 8-10 μg of mRNA from each sample was fragmented to the size of ~120-nt by Ambion Fragmentation reagent (Thermo Scientific AM8740 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and sequencing libraries were prepared from 5 ng of the purified amplicon using the NEBNext Ultra DNA Library Prep Kit for Illumina (New England Biolabs, E7370L) according to manufacturer’s protocol ...
-
bioRxiv - Genetics 2023Quote: ... Samples were then incubated in 30°C water bath for 5 hours with 50 μL of RCA mixture that contained 250 μM dNTP (New England Biolabs, N0447L), 1 mM extra-supplemented DTT ...
-
bioRxiv - Genetics 2022Quote: ... and 2 μg of DNA was digested with 50 units of NlaIII and 5 μL CutSmart® Buffer (NEB, cat #R0125L), in a total volume of 50 μL ...
-
bioRxiv - Developmental Biology 2023Quote: ... Eluted fragments were amplified by PCR with an appropriate number of PCR-cycles (5-8) using Custom NExtera PCR primers50 and the NEBNext High-Fidelity 2x PCR Master Mix (New England Biolabs, M0541S). Amplified DNA was purified using Qiagen MinElute Kit (Qiagen ...
-
bioRxiv - Genomics 2023Quote: ... Multiplex-polymerase chain reaction (PCR) was performed in two separate reaction mixes prepared by combining 5 μl of 5X Q5 Reaction Buffer (NEB, M0493S), 0.5 μl of 10 mM dNTPs (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... was modified with a guide RNA (GTCGGACGCGAAACTCGCTT) to target the 5’ region of the ROP33 gene (sgROP33) using Q5 mutagenesis (New England Biolabs, MA). Then a CRISPR/Cas9 replacement construct was created using Gibson assembly (New England Biolabs ...
-
bioRxiv - Microbiology 2023Quote: ... The 5’ termini of all ten DNA fragments (F1-F9 and the linker) were phosphorylated by using T4 PNK (NEB; #M0201), and the equimolar amounts (0.05 pmol each ...
-
bioRxiv - Biochemistry 2024Quote: ... and ligated to pre-adenylated linkers (NI-810 to NI-815) containing 5 nt sample barcodes unique for each sample using truncated T4 RNA ligase 2 (K227Q) (NEB; M0351L). Ligated fragments were separated from free linkers on a 15% polyacrylamide TBE-Urea gel and then pooled and purified for reverse transcription using RT primer NI-802 and ProtoScript II Reverse Transcriptase (NEB ...
-
bioRxiv - Microbiology 2024Quote: ... The mixture was incubated for 3 days at 37C in the dark for conjugation and purified for 3 rounds using Monarch PCR & DNA Cleanup Kit (5 µg) (NEB, T1030S) following the manufacturer’s instructions ...