Labshake search
Citations for New England Biolabs :
1851 - 1900 of 5921 citations for 7 BROMO 2 1 3 BENZOTHIADIAZOLE 4 SULFINIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2019Quote: ... Ten microliters of PCR products were digested with Nsi1 (3 hours with 5 units of Nsi1 enzyme (NEB)) and then ...
-
bioRxiv - Synthetic Biology 2021Quote: ... qPCR was carried out using the primers in Supplementary Table 3 and Luna Universal qPCR Master Mix (NEB) in a BioRad iCycler in technical triplicates for each biological replicate ...
-
bioRxiv - Immunology 2021Quote: ... we modified the plasmid using primers EpMap_1 and EpMap_2 along with ssODN EpMap1_ssODN (Extended Data Table 3) using the NEBuilder Mastermix (NEB, E2621S) following the manufacturer’s instructions in order to create hairpin-free overlap regions that could be used for homology-based library cloning ...
-
bioRxiv - Microbiology 2022Quote: ... 2.5µL of 10µM MBTUni-12 primer + 2.5µL of 10µM MBTUni-13 primer (5’-ACGCGTGATCAGTAGAAACAAGG-3’) + 10µL 5x HF Phusion Buffer + 1µL 10mM dNTPs mix (NEB #N0447S) + 0.5µL Phusion Polymerase + 28.5µL of Nuclease-free water (Ambion ...
-
bioRxiv - Molecular Biology 2020Quote: ... was added at 3’end of RA5) was ligated to RNA using T4 RNA ligase (New England Biolabs) at 25°C for 6 hr and 22°C for 6 hr ...
-
bioRxiv - Molecular Biology 2019Quote: ... HIS3_hp_For 5′ AAAAGCTTGACCGAGAGCAA and HIS3_hp_Rev 5′ GCGTATTACAAATGAAACCAAGATTCA) and initially cloned into pRS405 (3) between HindIII and XhoI (NEB). A DNA segment containing the GAL1 promoter ...
-
bioRxiv - Microbiology 2019Quote: The DNA oligo i116 that served as a 3’ adapter was adenylated using 5’ DNA Adenylation Kit (NEB), purified by ethanol precipitation as above and diluted to 10 μM with nuclease-free water.
-
The absence of C-5 DNA methylation in Leishmania donovani allows DNA enrichment from complex samplesbioRxiv - Molecular Biology 2020Quote: ... and cloned between 300 bp of PCR amplified DNA fragments of the LdBPK_250018100.1 5’ and 3’ UTR using NEBuilder (NEB) inside pUC19 for construct amplification in E ...
-
bioRxiv - Molecular Biology 2021Quote: ... Homology arms and exon 3 of the murine Akr1b3 locus were amplified with Q5 polymerase (New England Biolabs) using genomic DNA from mouse R1 ES cells (23) ...
-
bioRxiv - Systems Biology 2021Quote: ... Adaptors for Illumina sequencing were added via PCR amplification using Nspacer_barseq_pHIMAR (Wetmore et al., 2015) and NEBNext Index 3 Primer for Illumina (New England Biolabs). Cycle conditions were 30 seconds 98°C followed by 4 cycles (15 seconds 98°C ...
-
bioRxiv - Genomics 2020Quote: ... The sample was then combined with 3’ RNA Ligase Master Mix (8μL 50% PEG 8000, 2μL 10x T4 RNA Ligase Buffer (B0216L, NEB), 1.5μL nuclease free water ...
-
bioRxiv - Molecular Biology 2021Quote: ... R: 5’-ccgggaaaaactgaaaaaccattggcacgacaggtttcccgac-3’ from the pKAM555 vector) was inserted at the ClaI site using HiFi assembly (NEB). For the intTEL0 strain creation the pUC19LG plasmid (lacking the PstI(blunted)-BclI fragment of the HARS36 sequence ...
-
bioRxiv - Neuroscience 2021Quote: ... Phosphatase treated samples were enzymatically treated for 3 n at 37°C shaking (1.25 μl 10 μM MnCl2, 1.25 μl 20X NEB buffer ...
-
bioRxiv - Genomics 2021Quote: ... Resulting supercoiled plasmid is linearized at the 3’ end of the PolyA tail using BamHI-HF (NEB R3136S), and checked for reaction completion by running on agarose gel ...
-
bioRxiv - Genetics 2020Quote: ... the mutant Tile 3 was subcloned into the full length AttB-KCNH2-HA:IRES:mCherry by restriction digest with BglII and NdeI (NEB) and ligation with T4 ligase (NEB) ...
-
bioRxiv - Biochemistry 2022Quote: Ligation workups from the previous step were supplemented with 3 μL of 6X purple gel loading dye (NEB), heat denatured at 85 °C for 1 min ...
-
bioRxiv - Microbiology 2022Quote: ... Either 3-5 µL of Color Prestained Protein Standard-Broad Range (11-245 kDa) (New England Biolabs, P7712) or 1-3 µL of PageRuler Prestained Protein Ladder (10-180 kDa ...
-
bioRxiv - Microbiology 2022Quote: ... RNA was resuspended in 5 μl of water and the 3′ ends dephosphorylated with PNK (New England BioLabs) in MES buffer (100 mM MES-NaOH ...
-
bioRxiv - Synthetic Biology 2022Quote: ... the previously constructed genome-integrating vector pCS75 (25) (Supplementary Table 3) was cleaved with PmeI and EagI (NEB), the resulting fragments were separated on a 0.8% agarose gel ...
-
bioRxiv - Genetics 2022Quote: ... The second strand cDNA synthesis was performed using Klenow fragment 3’-5’ exo (New England Biolabs Inc, USA), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... followed by 3’ A-addition and adapter ligation using a custom reagent formulation (New England BioLabs, E6000B-10). Libraries were pooled in equal molar amounts and were sequenced using an Illumina HiSeqX platform (Ilumina ...
-
bioRxiv - Genomics 2023Quote: ... nick ligation was then performed in a 30 µL reaction with 3 µL of 10x rCutSmart Buffer (NEB), 1.56 µL of 500 µM β-Nicotinamide adenine dinucleotide (NAD+ ...
-
bioRxiv - Molecular Biology 2023Quote: ... using ETAA1 DBR R1 RT-PCR primer 5′-AAGTTCTTCTTCTTGACTTTGTGTT-3′ and treated with RNaseH (New England Biolabs, M0297S). 1μl of the cDNA was used for PCR amplification reactions using using GoTaq® G2 DNA Polymerase (Promega ...
-
bioRxiv - Developmental Biology 2023Quote: ... At least 3 sgRNAs per gene were cloned using ssDNAs oligoes (IDT) and NEBuilder HiFi DNA Assembly (NEB) into modified backbone ...
-
bioRxiv - Microbiology 2023Quote: ... The 3′ ends of purified RNA were dephosphorylated with the addition of T4 PNK enzyme (New England Biolabs) and 10 mM ATP was added to phosphorylate the 5’ ends of the RPF (ribosome protected fragments) ...
-
bioRxiv - Genomics 2023Quote: ... 2.5 µl of 100 mM dATP solution and 2.5 µl of Klenow Fragment (3′->5′ exo-) (NEB, #M0212L) were added to the mixture ...
-
bioRxiv - Microbiology 2023Quote: Purified vigR 3’ UTR amplified from JKD6008 was in vitro transcribed (IVT) using HiScribe T7 RNA polymerase (NEB). RNA products were DNase I treated (NEB ...
-
bioRxiv - Cell Biology 2023Quote: Ifnb1 mRNA 3’ UTR (NM_002176.4) was synthesized using the HiScribe T7 High Yield RNA synthesis kit (NEB, E2040S) through in vitro transcription ...
-
bioRxiv - Genomics 2023Quote: ... CBS 112042+ and CBS 124.78+ were sequenced on R9.4.1 flowcells using the LSK108 kit with 3 μg DNA as input for the end prep reaction (NEB ULTRA-II EP ...
-
bioRxiv - Cancer Biology 2024Quote: ... A single adenine base was added to fragment ends by Klenow fragment (3′ to 5′ exo minus; NEB), followed by ligation of Illumina adaptors (Quick ligase ...
-
bioRxiv - Microbiology 2024Quote: ... 1.25 µL native ligation barcode (ONT SQK-NBD114-96) and 3 µL Blunt/TA Ligase Master Mix (NEB). The reaction was mixed by pipetting ...
-
bioRxiv - Genomics 2024Quote: ... 3.) Library preparation was performed using the NEBNext Ultra II library preparation kit for Illumina (New England Biolabs) and 4. ...
-
bioRxiv - Cancer Biology 2021Quote: ... and capped and 2’-O-methylated with Vaccinia Capping System (NEB Biolabs). LNA oligos were transfected into unlabeled 4T1 cells using Lipofectamine 2000 (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... and capped and 2’-O-methylated with Vaccinia Capping System (NEB Biolabs). LNA oligos were transfected into unlabeled 4T1 cells using Lipofectamine 2000 (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2020Quote: ... 0.75 M NaCl) and 2 μl protein kinase K (NEB, Ipswich, USA) during 2 h at 60 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 mU of phosphodiesterase II from Sigma (# P9041-10 UN) and 2 U of alkaline phosphatase from Biolabs (# M0290) were added and the mixture was incubated at 37°C ...
-
bioRxiv - Genomics 2020Quote: ... and 2 μl of 1.5 μM NEBNext adaptors for Illumina sequencing (NEB): 5’-phos-GATCGGAAGAGCAC-ACGTCTGAACTCCAGTC/ideoxyU/ACACTCTTTCCTACACGACGCTCTTCCGATC*T-3’ and 5’-phos-GATCGGAAGAGCACACGTCTGAACTCCAGTC/ideoxyU/AC-ACTCTTTCCTACACGACGCTCTTCCGATC*C-3’ (* ...
-
bioRxiv - Cell Biology 2022Quote: ... Afterwards 2 µg of recombinant human Histone H3.1 (New England BioLabs, M2503), 100 µM S-(5′-adenosyl)-L-methionine chloride dihydrochloride (SAM ...
-
bioRxiv - Bioengineering 2022Quote: ... 0.25 μL of Phusion Hot Start DNA polymerase (2 unit/μL; NEB), 5 μL of 5x Phusion buffer (NEB ...
-
bioRxiv - Cell Biology 2022Quote: ... followed by 2 μL of 20 mg/mL RNaseA (New England BioLabs) for 30 min at 37 °C ...
-
bioRxiv - Genomics 2020Quote: ... Agarose was subsequently degraded by adding 2 μl of β-agarase (Biolabs). To stretch DNA fibers ...
-
bioRxiv - Genomics 2019Quote: ... For that the mix containing 2 µL of RNAse H (NEB, #M0297S), 1 µL of E ...
-
bioRxiv - Biochemistry 2019Quote: ... 400ng of library was amplified for 2 rounds using standard Phusion (NEB) PCR conditions ...
-
bioRxiv - Biochemistry 2019Quote: ... The protein was then passed over a 2 mL amylose column (NEB) and washed with 3 CV of Flag Wash Buffer ...
-
bioRxiv - Biophysics 2021Quote: ... Handle 2 was then digested with Lambda Exonuclease (M0262, New England BioLabs), which removes nucleotides from linearized double-stranded DNA in the 5′ to 3′ direction ...
-
bioRxiv - Biochemistry 2020Quote: ... 186 bp DNA (0.4 mg/ mL) in 1x NEBuffer 2 (NEB: B7002) was incubated with dATP (100 μM) ...
-
bioRxiv - Biochemistry 2020Quote: ... was de-phosphorylated with 2 μL of Calf Intestinal Phosphatase (NEB M0290S) for 1 hour with shaking (1250 rpm ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μM of 7MeGpppA or GpppA RNA cap analogue (New England Biolabs), 10 μM adenosyl-methionine (AdoMet ...
-
bioRxiv - Microbiology 2019Quote: ... (2) DSBs blunting with NEB’s Quick Blunting Kit (NEB, cat. number: E1201); (3 ...
-
bioRxiv - Biochemistry 2020Quote: ... PCR amplifications were carried out using 2 x Q5 Master Mix (NEB), with cycling times and temperatures according to the manufacturer’s instructions ...