Labshake search
Citations for New England Biolabs :
1801 - 1850 of 4641 citations for 6 Phenyl 1H imidazo 1 2 b pyrazole since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... followed by digestion to ribonucleotides by incubation for 2 h at 45 °C with 0.15 U of Nuclease P1 (NEB M0660S) in 10 mM ammonium acetate pH 5 ...
-
bioRxiv - Molecular Biology 2023Quote: The miRCat-33 3’ linker was ligated to the 3’ end of the RNAs on the Ni-NTA beads with 800 units of T4 RNA ligase 2 truncated K227Q (New England Biolabs) in 1 x PNK buffer / 16.67% PEG 8000 in the presence of 80 units RNasin in a total volume of 80 µl ...
-
bioRxiv - Genomics 2023Quote: ... mRNA was eluted from the oligo-dT beads and fragmented by incubating with the First Strand Synthesis Reaction buffer and Random Primer Mix (2×) from the NEBNext Ultra II Directional Library Prep Kit for Illumina (#NEBE7760; New England Biolabs) for 15Lmin at 94°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... was digested with BbsI enzyme and pre-annealed 5’-end phosphorylated sgDNA sequences (found in Extended file 2) inserted using Quick Ligase (New England Biolabs), and subsequently transformed into Stabl3 TM E ...
-
bioRxiv - Developmental Biology 2023Quote: ... for small RNA library preparation 50 to 300 ng of total RNA was ligated with randomized 3’ adapter using T4 RNA ligase 2 truncated KQ (NEB) in 1X T4 RNA ligase reaction buffer (NEB ...
-
bioRxiv - Developmental Biology 2023Quote: ... 50 nM of RCA primer, 1U/µL of RiboProtect (Blirt, #RT35) and 0.5 U/ µL of T4 RNA Ligase 2 (NEB, # M0239L). The ligation mix was introduced to the SecureSeal chamber and incubated on the samples for 2 hours at 37 degrees Celsius ...
-
bioRxiv - Cancer Biology 2023Quote: ... then split in 2 for PCR amplifications with either Minus or Plus primers using Q5 DNA Polymerase (New England Biolabs) with the following cycling conditions ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 µL i7 unique index primer (10 µM) and 25 µL NEBNext® High-Fidelity 2X PCR Master Mix (NEB) and subjected to the following PCR program ...
-
bioRxiv - Microbiology 2024Quote: ... Libraries were then size selected for cDNA target fragments of 200–300 bp on 2% Low Range Ultra Agarose followed by PCR amplified using Phusion DNA polymerase (NEB) for 15 PCR cycles ...
-
bioRxiv - Genomics 2024Quote: ... The purified scaffold insert (2 ng) was ligated with the digested intermediate plasmid library vector (200 ng) using T4 DNA Ligase (NEB) at room temperature for 45 min ...
-
bioRxiv - Microbiology 2024Quote: ... Libraries were then size-selected for cDNA target fragments of 200–300 bp on 2% Low Range Ultra Agarose followed by PCR amplification using Phusion DNA polymerase (NEB) for 15 PCR cycles ...
-
bioRxiv - Microbiology 2024Quote: ... 2 kb fragments upstream and downstream of SrcF were PCR amplified with Q5 High Fidelity DNA Polymerase (New England Biolabs) and cloned in PCR amplified pEx-deletion-ermG via DNA Gibson assembly (HiFi DNA Assembly Master Mix ...
-
bioRxiv - Systems Biology 2024Quote: ... We digested ∼2ug of each of 24 barcoded ORF plasmid pools (2 replicate pools of each of 9 hORFs and 3 vORFs) overnight with I-SceI (NEB) according to manufacturer’s recommendations ...
-
bioRxiv - Biophysics 2024Quote: ... cDNA (2 μl) was used as template in 50 μl PCR reaction with Phusion Hot start flex (New England Biolabs). Reaction conditions ...
-
bioRxiv - Plant Biology 2024Quote: ... with 2 µg of the freshly synthetized SgRNA1 obtained with the HiScribe™ T7 High Yield RNA Synthesis Kit (NEB). DNA repair templates containing the fenhexamid resistance cassette surrounded by 60 bp of the target gene for HR were obtained by PCR ...
-
bioRxiv - Plant Biology 2024Quote: ... Libraries were selected for cDNA target fragments of 300 bp on 2% Low Range Ultra Agarose followed by PCR amplified using Phusion DNA polymerase (NEB) for 15 PCR cycles ...
-
bioRxiv - Immunology 2023Quote: ... Completed libraries were then sequenced to an average depth of approximately 20M reads per sample on a partial lane of the NovaSeq6000 S4 XP flow cell using 2×150 paired-end reads with 10-base dual indexes (CAS: E6440S, NEB). After demultiplexing these samples ...
-
bioRxiv - Molecular Biology 2023Quote: ... Monophosphorylated RNAs were ligated to 3′ adapters ( rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/, IDT) using T4 RNA ligase 2 in 25% PEG 8000 (NEB) at 15°C overnight ...
-
bioRxiv - Pathology 2023Quote: Total RNA extracted from hearts of Ctrl and Eprs1cKO-homoat 2 weeks post tamoxifen injection were treated with DNase I (NEB) to remove potential genomic DNA in the RNA samples ...
-
bioRxiv - Molecular Biology 2024Quote: 100 ng polyA+ RNA was annealed with 2 μl of 10 μM Oligo(dT)30VN primer (5’-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN-3’) and 2 μl of 10 mM dNTP mix (NEB) in 12 μl solution ...
-
bioRxiv - Molecular Biology 2024Quote: ... Nicks were sealed by adding 10 μL 10x T4 DNA ligase buffer and 2 μL T4 DNA ligase (New England Biolabs) and incubating overnight at 16°C ...
-
bioRxiv - Microbiology 2024Quote: ... The SV40 NLS was added to the C-terminus of CypA via annealing partially complimentary primers encoding the SV40 NLS (Table S1) at 20 μM with NEB buffer 2 (New England Biolabs) at 95° C for 4 min and 70° C for 10 min ...
-
bioRxiv - Microbiology 2024Quote: Quantification of SARS-CoV-2 E gene subgenomic mRNA (sgmRNA) was conducted using Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) on a Step One Plus Real-Time PCR system (Applied Biosystems) ...
-
bioRxiv - Microbiology 2024Quote: ... Four PCR fragments of around 2,700 nucleotides long were generated from cDNA using primer pairs (Suppl. Table S2) with NEB Q5 Hot-Start high-fidelity 2× Master Mix (New England Biolabs). Fragments were gel-purified with MinElute gel extraction Kit (Qiagen ...
-
bioRxiv - Microbiology 2024Quote: ... Radioactively labelled tRNAs carrying a 2′,3′ cyclic phosphate at the 3′ end was dephosphorylated using T4 polynucleotide kinase (NEB) in 100 mM Tris-HCl pH 6.5 ...
-
bioRxiv - Biochemistry 2024Quote: Fab Fragments were generated by taking .5 mg of IgG and digesting with 2 µL of Lys C (NEB#P8109S) at 37℃ ...
-
bioRxiv - Biochemistry 2024Quote: ... After 30 mins the samples were placed on ice and 2 μl loading dye (Purple gel loading dye, no SDS, B7025 New England Biolabs) was added prior to loading 12 μl onto a 1.5% 15 x 15 cm 100 ml 0.5X TB agarose gel ...
-
bioRxiv - Biochemistry 2023Quote: ... Libraries were size selected for cDNA target fragments of 300 bp on 2% Low Range Ultra Agarose followed by PCR amplified using Phusion DNA polymerase (NEB) for 15 PCR cycles ...
-
bioRxiv - Cell Biology 2024Quote: ... each lysed by incubation in 1000 μL RIPA buffer + 2 mM PMSF + 60 μL PIC + 112.5 Kunitz Unit/mL DNase I (RNase-free, NEB M0303) + 2.5 mM MgCl2 (Sigma 5985-OP ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 2) library for miRNAs detection utilizing NEBNext® Small RNA Library Prep Set for Illumina (New England Biolabs (UK) Ltd ...
-
bioRxiv - Biophysics 2020Quote: ... 1 μL T4 polynucleotide kinase and 1 μL DpnI (New England Biolabs, Cats. #M0201S and R0176S) and incubated at 37°C for 1 hour ...
-
bioRxiv - Genomics 2022Quote: ... 1 μg of PCR product containing barcoded oligos were inserted into 1 μg SfiI (NEB, R0123) digested empty vector A or P by gibson assembly NEBuilder HiFi DNA Assembly Master Mix (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... 1 μL of 10 mM ATP and 1 μL of T4 DNA ligase (New England Biolabs) were added and the ligation reaction was incubated for 5 cycles at 20°C for one hour followed by 37°C for 30 min ...
-
bioRxiv - Cell Biology 2021Quote: ... and 1 mM MnCl2 only or together with 1 μl Lambda Protein Phosphatase (New England Biolabs). After incubation at 30°C for 30 min ...
-
bioRxiv - Microbiology 2022Quote: ... Filtered (0.45 μm) supernatants were treated with 1 U/ml DNAse I (NEB; 1 h, RT) and purified through a 20% sucrose cushion (2 h ...
-
bioRxiv - Bioengineering 2022Quote: ... Then CaCl2 was added to 2mM and 1 µL (about 1 µg) of Factor Xa (NEB) was added per 50 µg of protein and the samples were left at RT for 20-24h ...
-
A rapid, highly sensitive and open-access SARS-CoV-2 detection assay for laboratory and home testingbioRxiv - Molecular Biology 2021Quote: ... 1 μM Ultramer was annealed with 1 μM T7-3G oligonucleotide in 1x Taq Buffer (NEB) in a final volume of 10 μl by heating the reaction up to 95°C for 5 minutes ...
-
bioRxiv - Pathology 2022Quote: ... and 1 mM DTT containing [3H] SAM (25:1 molar ratio of SAM(NEB, Cat#B9003S) to [methyl-3H]-SAM (PerkinElmer ...
-
bioRxiv - Synthetic Biology 2019Quote: ... and inserts and plasmid were ligated at a 1:1 molar ratio with Quick Ligase (NEB) for 20 min at room temperature ...
-
bioRxiv - Zoology 2020Quote: ... Briefly: agarose plugs were pre-incubated for 1 hour with 1× Cutsmart buffer (New England Biolabs), followed by overnight incubation with 20U restriction enzymes HinfI and 20U RsaI (New England Biolabs ...
-
bioRxiv - Molecular Biology 2020Quote: ... The plug was then equilibrated twice in 1 ml of 1× NEBuffer 3.1 (New England Biolabs) by rotating the tube for 30 min at room temperature ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Reagents added were 1 μl of 1 mg/ml BSA (diluted from 20 mg/ml - NEB), 1 μl T4 DNA ligase buffer (NEB or Thermo Fisher Scientific) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Then 0.3 μL of 1 mg mL−1 trypsin (trypsin-ultra, MS-grade, New England Biolabs) was added and samples were incubated at 37 °C overnight ...
-
bioRxiv - Microbiology 2023Quote: ... Filtered (0.45 µm) supernatants were treated with 1 U/ml DNAse I (NEB; 1 h, RT) and purified through a 20% sucrose cushion (2 h ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 μL T4 DNA ligase (400 U/μl) and 1 μl BsaI-HFv2 (M0202S, R3733S, NEB) and water to 15 μl ...
-
bioRxiv - Neuroscience 2023Quote: ... The oligonucleotides were mixed at a 1:1 ratio and phosphorylated with T4 PNK (NEB, M0201) and annealed in T4 ligase buffer (NEB ...
-
Essential roles of the ANKRD31-REC114 interaction in meiotic recombination and mouse spermatogenesisbioRxiv - Genetics 2023Quote: ... Plugs were washed in 500 µl of 1× T4 polymerase buffer (1× T4 ligase buffer (NEB) supplemented with 100 μg/ml BSA and 100 μM dNTPs (Roche) ...
-
bioRxiv - Microbiology 2024Quote: ... and used in a 1:1 molar ratio Golden Gate assembly reaction with BsaI-HF2 (NEB) and T4 ligase (NEB ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 1 µL T4 PNK (NEB) followed by incubation for 60 min at 37 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 μl (10U) T7 endonuclease (NEB) were added to the hybridized PCR products and incubated for 15min at 37°C ...