Labshake search
Citations for New England Biolabs :
1751 - 1800 of 4748 citations for 8 BROMO 2 3 4 5 TETRAHYDRO 1H PYRIDO 4 3 B INDOLE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... 5 mM MgCl2, 10% Glycerol, 0.05% NP-40, 2 mM DTT, 10 mM Ribonucleoside-Vanadyl complex [New England Biolabs, MA USA] ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5 µl 10 x dNTPs with dUTP instead of dTTP (2 mM each) and 1 µl T4 polymerase (NEB) were added and the mixture was incubated at 37°C in a thermal cycler for 20 min ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and 5 µl of CutSmart buffer and 2 µl of EcoRI-HF® (New England Biolabs, catalog no. R3101) were added before incubation for 6 h at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... DNA oligonucleotides (Supplementary Table 2) were radiolabeled at the 5’ end by T4 Polynucleotide kinase (PNK) (New England Biolabs) treatment and [γ-32P] (PerkinElmer ...
-
bioRxiv - Genetics 2022Quote: ... 1 µL of extracted genomic DNAs and 5 µL of 2× Hot Start High Fidelity Q5 Master Mix (NEB). PCR reactions were carried out under the following condition ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.1pmol of each fragment were then assembled for 1h at 50°C using NEBuilder HiFi DNA Assembly master mix from the NEBuilder HiFi DNA Assembly Cloning Kit (NEB, ref E5520S). Reaction products were amplified in provided bacteria and purified using QIAprep Spin Miniprep Kit.
-
bioRxiv - Molecular Biology 2020Quote: ... using 8 units of T4 RNA ligase 1 (NEB) and 8 nmol of ATP in a final volume of 8 μl for 1 h at 37°C ...
-
bioRxiv - Cancer Biology 2019Quote: ... 8 μL of BSA (20 mg/mL B9000S, NEB,) and 100 Units of ligase (M0202M ...
-
bioRxiv - Genomics 2022Quote: ... and 8 units/μL T7 RNA Polymerase (NEB, M0251S) in the transcription buffer (40 mM Tris-HCl pH 8 ...
-
bioRxiv - Pathology 2021Quote: ... 8 neuraminidases (both New England BioLabs, Ipswich, MA, US) separately or in combination according to the manufacture’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 8 µM BC-647 (CLIP-Surface 647, NEB) in a base solution of Passive Lysis Buffer was rotated overnight at 4°C to label CLIP-tagged proteins ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 8 µL of 5x Phusion HF Buffer (NEB #B0518S), and 3.2 µL of 2.5 mM dNTPs (NEB #N0447 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 8 µL of 5x Phusion HF Buffer (NEB #B0518S), and 0.8 µL of 10 mM dNTPs (Takara #4030) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 8 µL of 5x Phusion HF Buffer (NEB #B0518S), and 2 µL of 2 mM dNTPs ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 8 µL of 5x Phusion HF Buffer (NEB #B0518S), and 0.8 µL of 10 mM dNTPs (Takara #4030) ...
-
bioRxiv - Cell Biology 2023Quote: ... 8 U/μl Salt-T4 DNA ligase (NEB #M0467)) ...
-
bioRxiv - Genomics 2023Quote: ... 8 μL of 5X Induro RT Buffer (NEB M0681S), 12.6 μL nuclease free water ...
-
bioRxiv - Biochemistry 2022Quote: ... RNase B from bovine pancreas (New England Biolabs, Ipswich MA, USA), and horse radish peroxidase (HRP ...
-
bioRxiv - Synthetic Biology 2023Quote: ... the PURExpress® kit containing Solution A and Solution B (NEB) was used to prepare the transcription-translation reaction ...
-
bioRxiv - Microbiology 2024Quote: ... coli B strain was dephosphorylated with 0.4 U/µL QuickCIP (NEB) in 1 x rCutSmart buffer (NEB ...
-
bioRxiv - Biophysics 2021Quote: ... PfK5ΔL6-MD-SNAP was biotinylated or fluorescently labelled by overnight incubation at 4°C with SNAP-Biotin® or SNAP-Surface® Alex Fluor® 647 (New England BioLabs) with at least a 3:1 molar excess of these labels to PfK5ΔL6-MD-SNAP ...
-
Comprehensive profiling of antibody responses to the human anellome using programmable phage displaybioRxiv - Immunology 2022Quote: 5 μl ligation reactions were set up with a total of 500 ng DNA (vector and insert at a 1:4 molar ratio) and high-concentration T4 DNA ligase (NEB Cat No. M0202T). The ligation mix was packaged using the T7Select Packaging Extract (EMD Millipore ...
-
bioRxiv - Cancer Biology 2019Quote: ... sequences are listed in Supplementary Table 4) and cloned into pGL3-TK-5UTR-BsmBI-Luciferase using BsmBI (New England BioLabs; Whitby, Ontario, Canada). The “Snail 417” UTR insert was generated by PCR using the forward primer TATCGTCTCAACACCGAGCGACCCTGCATAAGCTTGGCGCTGAGCCGGTGGGCG and the reverse primer ATACGTCTCTCTTCCATAGTGGTCGAGGCACTGGGGTCG ...
-
bioRxiv - Pathology 2021Quote: RT-qPCR was also performed on RNA extracted from the 4 dpi lung samples with NEB Luna Universal One-Step RT-qPCR Kit with SYBR-Green (NEB, Ipswich, MA, USA) to quantify the cytokines IL-6 and IFN-β ...
-
bioRxiv - Microbiology 2020Quote: ... Two and a half μL of each fragment at equimolar concentration was added to 5 μL 2× Gibson master mix (NEB), and the mixture was incubated at 50°C for 60 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... Gluc200 and Gluc200A44 templates were generated using PCR amplification of GLuc of the first 200 nt at the 5’end of pCMV-GLuc 2 Control Plasmid (NEB: https://www.neb.com/tools-and-resources/interactive-tools/dna-sequences-and-maps-tool) ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 2 μl of the assembled mix (∼5 ng of vector backbone) was transformed into competent cells (NEB, cat# C2987H), followed by spreading on antibiotic-selective LB agar plates ...
-
bioRxiv - Biochemistry 2022Quote: ... D-loops were deproteinized by adding 2 μL of 5% lithium dodecyl sulfate and 1 μL of 20 mg/mL proteinase K (New England Biolabs), and incubating the mixture at 37°C for 15 min ...
-
bioRxiv - Genetics 2022Quote: ... 2 μg of DNA was digested with 50 units of DpnII and 5 μL NEBuffer™ DpnII (NEB, cat #R0543L), in a total volume of 50 μL ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.5 mM each of forward and reverse primers (Supplemental Table 2) and 0.5 U Phusion® HF DNA polymerase (NEB) in a reaction volume of 25 μl ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were generated by 5-7 rounds of PCR amplification using NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L), purified using SPRIselect reagent kit (Beckman Coulter ...
-
bioRxiv - Cancer Biology 2023Quote: ... The digested vector was combined with the amplified inserts in a 5:2 ratio by mass and ligated using a 2X Gibson Assembly Master Mix (NEB) at 50 °C for 30 minutes ...
-
bioRxiv - Bioengineering 2023Quote: ... Cells were washed two times in barcode wash buffer (+5 μM each of quenching oligo 1 & 2) and then resuspended in ice cold 1x ThermoPol reaction buffer (NEB) cells were passed through a 40μm strainer and counted ...
-
bioRxiv - Cancer Biology 2023Quote: ... was digested with BbsI enzyme and pre-annealed 5’-end phosphorylated sgDNA sequences (found in Extended file 2) inserted using Quick Ligase (New England Biolabs), and subsequently transformed into Stabl3 TM E ...
-
bioRxiv - Biochemistry 2024Quote: Fab Fragments were generated by taking .5 mg of IgG and digesting with 2 µL of Lys C (NEB#P8109S) at 37℃ ...
-
bioRxiv - Biochemistry 2020Quote: ... m7G(5′)ppp(5′)G (NEB, #S1404S) and m7G(5′)ppp(5′)A (NEB ...
-
bioRxiv - Genetics 2021Quote: ... 5 μg of MBP-Rif2 or MBP-Rif2-min (see recombinant protein preparation) was incubated for 1 h at 4 °C with amylose resin (New England Biolabs, 50 μl per reaction). The resin with the immobilized MBP-Rif2 variants was washed 5 times with 1 ml wash buffer (50 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Plant Biology 2024Quote: ... when OD600 reached 0.5 for 4 h at 37 °C and then they were purified using amylose resin column (New England Biolabs, for MBP related proteins purification) or Ni-NTA agarose column (Qiagen ...
-
bioRxiv - Biochemistry 2022Quote: ... purified KRAS protein was mixed with GMP-PNP (molar ratio of 10:1 GMP-PNP:KRAS) and calf intestinal alkaline phosphatase (NEB cat# M0290, 3 units per mg of KRAS). The reaction mixture was incubated for 3 hours at room temperature and then purified by size-exclusion chromatography on a 10/300 Superdex 75 GL column (GE Healthcare ...
-
bioRxiv - Molecular Biology 2020Quote: ... and PCR amplified (8-12 cycles) with Phusion polymerase (NEB) using custom primers (22) ...
-
bioRxiv - Biochemistry 2019Quote: ... samples were mixed into an 8%-by-volume Dpn1 (NEB) digestion reaction (37 °C ...
-
bioRxiv - Bioengineering 2021Quote: ... 8 μL of 5X Quick Ligation Reaction buffer (NEB: B6058S), 6 μL of the RMX adapter and 3 μL of T4 DNA ligase (2,000,000 units/mL).
-
bioRxiv - Neuroscience 2020Quote: ... and incubated with 8 μl of T4 Polynucleotide Kinase (NEB) and 2 μl of 10 mM ATP for 30 min at 37 °C ...
-
bioRxiv - Molecular Biology 2021Quote: 8 different polymerases (KAPA HiFi HotStart, Qiagen Taq, Q5 (NEB), Phusion Hot Start Flex DNA Polymerase (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 8 units of Bst 2.0 warmstart DNA polymerase (NEB) followed by incubation at 60°C for 2 minutes to extend the strand with EdUTP-containing DNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... was mixed with 8 mM m7G cap analog (ARCA; NEB), TMG cap analog (Jena Bioscience ...
-
bioRxiv - Biophysics 2023Quote: ... 8 mM ATP and 10 units of T4 ligase (NEB) were incubated overnight at 16°C ...
-
bioRxiv - Cell Biology 2019Quote: ... stained with oligo-conjugated WGA at a concentration of 2-5 μg/mL in 1× HBSS with 2000× diluted murine RNase inhibitor (New England Biolabs, M0314L) at 37 °C for 20 min ...
-
bioRxiv - Evolutionary Biology 2021Quote: 5’ adapter ligation was performed by adding 3 uL of 10uM 5’ adaptor (which was previously denatured by heating to 70 C for 2 minutes and placed on ice, NEB E7330L), 2 uL of 10X T4 RNA ligation buffer (NEB B0216L) ...
-
bioRxiv - Biochemistry 2020Quote: ... Cross-links were reversed from eluted chromatin by adding 6 μL of 5 M NaCl and 2 μL Proteinase K (NEB; P8107S) and incubation overnight at 65°C ...