Labshake search
Citations for New England Biolabs :
1751 - 1800 of 2828 citations for 6 Hydroxy 3 nitro 2 picoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... and a synthetic 391 bp double-stranded DNA fragment encoding 5′-(1st gRNA/scaffold/H1 promoter/2nd gRNA)-3′ was inserted using the NEBuilder HiFi assembly system (NEB). Synthetic DNA fragments were ordered from Genewiz and sequences are listed in Table S6 ...
-
bioRxiv - Genomics 2023Quote: Each 900 ng of high molecular weight NA12878 DNA was preprocessed by first blocking at the 3’ ends with Klenow (exo-) (NEB) in the presence of 10 µM dideoxynucleotides and 1X NEBuffer 3.1 for 30m at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... cDNA was diluted 1:10 and 3 µl of diluted cDNA was used as input for qPCR using Luna by NEB master mix for a 20 µL total reaction ...
-
bioRxiv - Microbiology 2023Quote: Lysates of U2OS cells infected with wild-type HSV-2 186 at an MOI of 3 for 24 h were treated with calf intestinal alkaline phosphatase (CIP) (New England BioLabs) as described previously60.
-
bioRxiv - Microbiology 2023Quote: ... Double stranded on-bead DNA was digested with a mix of 3 blunt cutting enzymes (SspI-HF, StuI, and HincII) (NEB) to generate blunt-end DNA ...
-
bioRxiv - Genomics 2023Quote: ... The DNA with end tags was oxidized in 15 μL TET2 reaction mix (3 μL TET2 reaction buffer plus reconstituted TET2 reaction buffer supplement (NEB), 0.3 μL oxidation supplement (NEB) ...
-
bioRxiv - Genomics 2023Quote: ... The backbones for the Gibson reaction for GRB2-SH3 and PSD95-PDZ3 library assembly (aPCA plasmids) were first linearized using primers listed in Extended Data Table 3 and next treated with Dpn1 (NEB) restriction enzyme to remove the circular plasmid template ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5′ phosphorylated and 3’ A-tailed by NEBNext Ultra II End Prep Enzyme Mix following the manufacturer’s instruction (New England Biolabs #E7645L). An adaptor was ligated ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the radiolabeled 3’ fragment was ligated to an unlabeled 5’ fragment by splinted ligation with T4 DNA ligase (NEB) at 30°C for 2 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... The 3′ adapter was conjugated with an amino CA linker instead of dCC at the 3′ end (GeneDesign) and adenylated using 5′ DNA adenylation kit at the 5′ end (NEB). To reduce a ligation bias ...
-
bioRxiv - Bioengineering 2023Quote: ... The error-prone PCR (with an error rate of 3- to 5-nucleotide mutations per kilobase) was carried out with the Taq DNA polymerase (New England BioLabs) in a reaction containing 2 µl of 10 mM primers ...
-
bioRxiv - Neuroscience 2024Quote: Adult worms from INF418 (nonEx106[myo-2p::GCaMP8f::unc-54 3’UTR]) and INF96 (syIs391[myo-2p::NLS::GAL4SK::VP64::unc-54 3’UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] ...
-
bioRxiv - Microbiology 2024Quote: The msdDNA cDNA was isolated from acrylamide gels and 100 ng was used to extend the 3’ end with dCTP or dGTP and terminal deoxynucleotidyl transferase (TdT) from NEB, according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... reverse 5’-GTGGCC CTCGAG TCA GTG AGT TTC ATG TTG G-3’ and then purified using the Monarch PCR plus DNA purification kit (NEB). The purified PCR product was digested by KpnI and XhoI (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... A second DNA adapter (containing a random-mer of 10 (N10) random bases at the 5′ end) was then ligated to the cDNA fragment 3′ end (T4 RNA Ligase, NEB) in the presence of a high concentration of PEG8000 and dimethyl sulfoxide (DMSO) ...
-
bioRxiv - Genetics 2023Quote: ... and SWI4 3’UTR (1000 bases downstream of ORF) were cloned into a LEU2 single integration vector by Gibson assembly (NEB) (Gibson et al. ...
-
bioRxiv - Molecular Biology 2024Quote: ... IP samples underwent on-bead ligation of barcoded RNA adapters (/5phos/rArGrArUrCrGrGrArArGrArGrCrGrUrCrGrUrG/3SpC3/) to the 3’ end using T4 RNA ligase (New England Biolabs). Following elution ...
-
bioRxiv - Molecular Biology 2024Quote: The golden gate assembly reaction was assembled in a PCR tube by mixing 100 ng of the vector with a 3 fold molar excess of the purified PCR product (calculated using the NEB bio calculator ...
-
bioRxiv - Molecular Biology 2024Quote: ... the double-stranded (ds) cDNA was PCR amplified with primers directed against 5’ and 3’ RNA cassettes and NEB Q5 HotStart polymerase (NEB). To introduce unique barcodes secondary PCR was performed using TrueSeq primers (NEB ...
-
bioRxiv - Cell Biology 2024Quote: ... and 5’-ACG CGT ACT AGT CGA TCG CTT GTA CAG CTC GTC CAT G-3’ (reverse primer) and using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... without its Stop codon and with a Gly-Gly-Ser-Gly-linker at the 3’-end was first amplified using Q5 High-Fidelity DNA Polymerase (New England Biolabs) and the primers GGB_OEP7_F – AACAGGTCTCAAACAATGGGAAAAACTTCGGGAGC and GGC_OEP7_GGSG_R – AACAGGTCTCTAGCCTCCAGATCCTCCCAAACCCTCTTTGGATGTGG ...
-
bioRxiv - Biochemistry 2024Quote: ... and tRNAGln with 5 nt-long 5’ leader and same 24 nt-long 3’ trailer as tRNATyr (5–tRNAGln–24) – were transcribed in reactions containing 1x T7 RNA polymerase reaction buffer (NEB), 0.001% (w/v ...
-
bioRxiv - Bioengineering 2024Quote: ... Illumina adapters were ligated on at the 3′ end of the complementary strand using 1× TA Ligase Master Mix (NEB). All products were indexed and sequenced on an Illumina MiSeq instrument ...
-
bioRxiv - Bioengineering 2024Quote: ... anchored primer was used to create a complementary strand to the TdT extended products using 15 units of Klenow Fragment (3′→5′ exo-) (NEB) in 1× NEB2 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and two BsmBI Type IIS restriction enzyme sites was cloned into the 3’ end of the bovine U6 promoter using Gibson Assembly (NEBuilder HiFi, NEB) (see Supplementary Figure 1a) ...
-
bioRxiv - Genetics 2021Quote: ... 2 µL of Taq DNA polymerase (LongAmp Taq DNA Polymerase kit, New England Biolabs), 7.5 µL of dNTPs (dNTP set ...
-
bioRxiv - Molecular Biology 2021Quote: ... and NEBNext Multiplex Oligos for Illumina Primer sets 1 and 2 (New England Biolabs). The libraries were amplified with 7 PCR cycles using Herculase II Fusion Polymerase kit (Agilent) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 2 hours at 55°C with 0.1 mg/ml Proteinase K (NEB P8107S).
-
bioRxiv - Developmental Biology 2021Quote: ... 1 μL RT Adapter (RTA)(SQK-RNA002) and 2 μL T4 DNA Ligase (NEB) were mixed together and incubated under 25 °C for 10 min ...
-
bioRxiv - Molecular Biology 2022Quote: pLXV-EF1alpha-2xStrep-SARS-CoV-2-nsp14-IRES-Puro was opened with NdeI (NEB) and AfeI (NEB) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and then the extracted RNA was treated with 2 units of DNase I (NEB) and further cleaned up via phenol-chloroform (pH 4.3 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 15 μL of 2× Phusion High-Fidelity PCR Master Mix (New England Biolabs). All PCR amplification reactions were carried out on a T100 Thermal Cycle (Bio-Rad ...
-
bioRxiv - Molecular Biology 2019Quote: ... 25 μL of NEB Next High-Fidelity PCR Master Mix (2×) (NEB, Ipswich, USA), 1 μL of Universal PCR Primer (25 mmol ...
-
bioRxiv - Developmental Biology 2019Quote: Pceh-23_L::acy-2(genomic) was generated with a Gibson assembly cloning kit (NEB) by assembly of the following two DNA fragments ...
-
bioRxiv - Biochemistry 2019Quote: ... then ligated to purified RNA species using T4 RNA Ligase 2 Truncated (NEB #M0242S) at 25°C for 1 h ...
-
bioRxiv - Physiology 2019Quote: ... PCR was performed using Phusion Hot Start Flex 2× Master Mix (NEB, Frankfurt, Germany) in a GeneAmp PCR system 9700 (Applied Biosystems ...
-
bioRxiv - Immunology 2019Quote: ... was added to 2 pmol of pooled oligos by terminal transferase (New England Biolabs), oligos were labeled withAlexa647 NHS-ester (Life Technologies ...
-
bioRxiv - Physiology 2021Quote: ... 5’ end repair was done using T4 PNK with 2 mM ATP (NEB P0756S). Following RNA purification with Zymo Oligo Clean & Concentrator (D4060) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Barcoded pre-adenylated linkers were ligated using T4 RNA ligase 2 truncated K227Q (NEB) and rRNA was depleted using the Ribo-Zero gold kit (Illumina ...
-
bioRxiv - Neuroscience 2020Quote: ... Sections were quenched with 2% H2O2 and digested in 10µg/ml Proteinase K (BioLabs). The reaction was stopped with 2mg/ml Glycine (Sigma ...
-
bioRxiv - Plant Biology 2020Quote: ... The nuclei were washed two times with a plastid-lysis buffer (NEB + 2% triton) followed with centrifugation (5 min at 1500 g ...
-
bioRxiv - Bioengineering 2020Quote: ... half of the DNA was mixed with 2 μL ExoI (M0293S, New England Biolabs), 1 μL of Lambda Exonuclease (M0262S ...
-
bioRxiv - Bioengineering 2020Quote: ... 2 μL of PCR mixture was used for 10 μL KLD reaction (NEB, MA), which proceeded under room temperature for 1 hour ...
-
bioRxiv - Cancer Biology 2020Quote: ... and NEBNext Multiplex Oligos for Illumina (NEB Set 1 E7335 and Set 2 E7500S). Additional AMPure clean-ups at the start and the end of library preparation were included ...
-
bioRxiv - Plant Biology 2021Quote: ... for level 2 reaction together with T4 DNA Ligase (New England BioLabs, Ipswich, UK). TCSn promoter DNA sequence (Zürcher et al. ...
-
bioRxiv - Biochemistry 2021Quote: ... and 2 µg DNA was treated with uracil DNA glycosylase (New England Biolabs, Inc.) at 37 °C for 60 min ...
-
bioRxiv - Systems Biology 2021Quote: ... 2 micrograms of each library was digested with SphI-HF and SpeI-HF (NEB) and then treated with Antarctic phosphatase (NEB).
-
bioRxiv - Systems Biology 2020Quote: ... Samples were digested using 2 Units/μL MNase in 20μL MNase Digestion Buffer (NEB) for 5 minutes at 37°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... for 10 min with 2 mM Ribonucleoside-Vanadyl Complex RVC (New England Biolabs, S1402S) at room temperature and then permeabilized for 5 min on ice in 0.5% Triton-X with 2mM RVC ...
-
bioRxiv - Cell Biology 2021Quote: ... and cloning was performed using Gibson Assembly 2× Master Mix (New England BioLabs, NEB) following the manufacturer’s instructions ...