Labshake search
Citations for New England Biolabs :
1751 - 1800 of 2049 citations for 6 Benzyloxy 1H indole 2 boronic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... The irf8 st95 mutation abolishes an AvaI restriction site and this line was genotyped by PCR (primers in Table 2) and AvaI digest (NEB), as previously described (Shiau et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... The homology-directed repair (HDR) plasmid for C-terminal SAX-2::GFP(ju1831) was made using three-fragment Gibson Assembly (New England Biolabs) in which two sax-2 homology arms containing 498 bp upstream of the sax-2 TAA stop codon and 540 bp downstream of the sax-2 TAA stop codon plus the stop codon were amplified from N2 genomic DNA and fused such that they flanked GFP (pDD282) ...
-
bioRxiv - Microbiology 2024Quote: ... Diluted supernatants were used as the template DNA (5 μL) for qPCR using a 2×Luna universal qPCR master mix (New England BioLabs), with 0.5 μM of primers ...
-
bioRxiv - Biochemistry 2024Quote: ... The cDNA was diluted 1:50 in ddH2O and 2 µL used as a template in a 15 µL reaction using the Luna Universal qPCR Master Mix (NEB) on a Rotor-Gene Q (Qiagen) ...
-
bioRxiv - Microbiology 2024Quote: ... followed by excision and ligation for 2 hours at room temperature using the Instant Sticky-end Ligase Master Mix (NEB) in accordance with the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... The NEBuilder Assembly Tool was used to design primers for amplification of each component of the donor plasmid (Table 2) using Phusion (NEB); purified PCR products were assembled using NEBuilder HiFi DNA Assembly Master Mix (NEB) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purified extension products were denatured and ligated to adaptor 2 (Ad2, Supplementary Table 3) by Instant Sticky-end Ligase Master Mix (New England Biolabs) at 4 °C overnight ...
-
bioRxiv - Microbiology 2024Quote: ... The SARS-CoV-2 Spike coding region was then amplified using Q Hot Start High-Fidelity DNA Polymerase (New England Biolabs) with forward (5’ TCATCGATGCATGGTACGCCACCATGTTTGTTTTTCTTGTTTTATTG 3’ ...
-
bioRxiv - Microbiology 2024Quote: ... the RNA pellet was resuspended in 50 µl of RNase-free H2O and 1 µl of the resuspended samples was used for quantification of the DENV-2 D220 NS5 RNA regions using Luna Universal One-Step RT-qPCR Kit (New England Biolabs) in a 10-ul reaction volume ...
-
bioRxiv - Molecular Biology 2024Quote: ... Deletion constructs were made by PCR amplification of the appropriate regions and cloned into the Cilantro 2 vector using Gibson cloning (New England Biolabs). Lentiviral particles carrying the respective constructs in the Cilantro 2 vector were produced and used to transduce MOLM-13 cells as described above ...
-
bioRxiv - Biochemistry 2024Quote: ... pETDuet-1 vector was linearized by digestion with PacI and NdeI and gene fragments were inserted into multiple cloning site 2 (MCS2) of the linearized plasmid via Gibson assembly using the New England BioLabs (NEB) Gibson Assembly Master Mix and following the manufacturer’s standard protocol ...
-
bioRxiv - Developmental Biology 2024Quote: ... along with 5 ng/μl Pmyo-3::GFP and 20 ng/μl of 2-Log DNA ladder (New England BioLabs), to generate the DLS344 strain ...
-
bioRxiv - Genomics 2024Quote: ... with a final extension of 72 °C for 2 minutes using Q5 Hot Start High-Fidelity DNA Polymerase (NEB M0493L). We used 7 cycles for all amplicons ...
-
bioRxiv - Plant Biology 2024Quote: ... To obtain CRISPR-Cas9 mutant alleles of RELK1 one guide RNA specific for exon 2 was cloned into pBUE411 by HiFi cloning (NEB). The resulting construct was introduced into Hi-II immature embryos by Agrobacterium-mediated transformation ...
-
bioRxiv - Plant Biology 2024Quote: To obtain CRISPR-Cas9 mutant alleles of RELK2 and RELK3 a dual targeting guide RNA specific for exon 2 was cloned into pBUE411 by HiFi cloning (NEB). To obtain CRISPR-Cas9 mutant alleles of RELK1 one guide RNA specific for exon 2 was cloned into pBUE411 by HiFi cloning (NEB) ...
-
bioRxiv - Genomics 2024Quote: ... crRNAs were amplified from genomic DNA (primer sequences can be found in (Supp. Table 2) using Q5 2x Master Mix (NEB) in 100 μL reactions with the following thermal cycling parameters:
-
bioRxiv - Cell Biology 2024Quote: ... we microinjected 5 ng/μl Pmyo-3::GFP and 95 ng/μl of 2-Log DNA ladder (New England BioLabs) into the germline of GRD-3::mKate2 animals to generate transgenics expressing a muscle-specific GFP marker.
-
bioRxiv - Biochemistry 2024Quote: ... and ligated to a preadenylated oligonucleotide linker (NI-816: 5’-/5Phos/NNNNNTAGACAGATCGGAAGAGCACACGTCTGAA/3ddC/-3’) using T4 RNA Ligase 2 truncated KQ (NEB). Unligated linker was depleted by treatment with yeast 5’-deadenylase (NEB ...
-
bioRxiv - Microbiology 2024Quote: ... was amplified using primers OVL7966 and OVL6481 and the PCR product was excised from a 2% agarose gel using the Monarch DNA cleanup and gel extraction kit (NEB). One-step Golden Gate Assembly (GGA ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The addition of an NLS or DST to level 1 and level 2 integrase constructs was performed using PCR-mediated site-directed mutagenesis (NEB Q5 Site-Directed Mutagenesis ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and 0.2 μl 50x oligos of the AarI recognition site for Level 0 and Level 2 cloning or Eco31I/BsaI-HFv2 (ThermoFisher/NEB) for Level 1 cloning ...
-
bioRxiv - Molecular Biology 2024Quote: ... All others cloning were classically performed by vector and PCR products restriction for 2 hours at 37°C in Cutsmart Buffer (New England Biolabs) with appropriate restrictions enzymes (BamHI ...
-
bioRxiv - Microbiology 2024Quote: ... For screens in the VAND and VEG strains a novel vector pCas9-GFP-DHFR-TS::sgRNA was created by Gibson cloning the DHFR-TS selection cassette amplified with primers 1-2 from the template GRAx-TGGT1-069070-DHFR-TS in pCas9-GFP-HXGPRT::sgRNA double-digested with SmaI/EcoRI (NEB). PCRs were performed with the proof-reading polymerase KOD (Sigma-Aldrich) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 10 µg genomic DNA per sample was mock treated or treated with 2 U/µg DNA of RNaseH (NEB, M0297) for 2 h at 37 °C ...
-
bioRxiv - Microbiology 2024Quote: Plasmids (Supplementary Table 2) were purified from overnight bacterial cultures using the Monarch Plasmid Miniprep Kit (New England Biolabs, UK). Polymerase chain reaction was carried out using Q5 high-fidelity polymerase (New England Biolabs ...
-
bioRxiv - Microbiology 2024Quote: ... SIVsmm Vpr and Nef expression constructs were described before20,51 Chimeric HIV-2 and SIVsmm infectious molecular clones as well as CG mutants thereof were generated using Gibson assembly (NEB) and cloned into pCR XL TOPO or pBR vector using NotI/MluI restriction sites using primers listed in Table 1 ...
-
bioRxiv - Biophysics 2024Quote: ... We digested the pBS-parS for 2 h at 37°C using NotI-HF or XhoI restriction enzymes (New England Biolabs) and heat-inactivated for 20 min at 80°C ...
-
bioRxiv - Microbiology 2024Quote: ... Site-directed mutagenesis was performed to engineer alanine or glutamic acid substitution mutations in Tax1bp1 using the primers listed in Table 2 and the Q5 site-directed mutagenesis kit (New England Biolabs). Open reading frames (ORFs ...
-
bioRxiv - Molecular Biology 2024Quote: ... 50 µL reactions were prepared for the second PCR by mixing 25 µL of 2× Phusion High-Fidelity PCR Master Mix (New England Biolabs), 15 µL of cleaned-up PCR product from the first PCR and 10 µL Nextera DNA CD Indexes (96-well format from Illumina ...
-
bioRxiv - Plant Biology 2024Quote: ... The OsXLG crRNA target sequences were amplified using gene-specific primers (SI, Table 2) and Q5 Hi-Fi DNA polymerase (NEB). The PCR amplicons were subjected to Sanger sequencing and analyzed using CRISP-ID online software (Dehairs et al. ...
-
bioRxiv - Microbiology 2024Quote: ... And a positive control reaction was performed where lysate was substituted with 2 µL (20 U) of purified Exonuclease I (NEB). Reactions were allowed to incubate for 1 min at room temperature ...
-
bioRxiv - Microbiology 2024Quote: ... A 20 µL Gibson Assembly reaction was performed with 50 ng of vector at a 2:1 ratio for 1 hour (New England Biolabs NEBuilder HiFi DNA Assembly Master Mix ...
-
bioRxiv - Cell Biology 2024Quote: ... Size-selected DNA fragments were amplified using NEB unique multiplexed i5 and i7 primers (E6440) in a total reaction volume of 100 µl together with 2 U Phusion High-Fidelity DNA Polymerase (NEB) and in the presence of 0.2 mM dNTPs and 1X Phusion High-Fidelity buffer ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA of 2×106 cells was extracted with the Monarch Total RNA Miniprep Kit with “on column” DNase I treatment (NEB). cDNA was generated by using LunaScript RT SuperMix Kit (NEB ...
-
bioRxiv - Cancer Biology 2024Quote: ... then split in 2 for PCR amplifications with either Minus or Plus primers using Q5 DNA Polymerase (New England Biolabs) with the following cycling conditions ...
-
bioRxiv - Molecular Biology 2024Quote: ... The ends of DNA were repaired by incubating in 70 μL of 1X NEBuffer 2 containing 0.6 units of T4 DNA polymerase (NEB, M0203S), 2 units of T4 polynucleotide kinase (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... Beads containing the repaired DNA were resuspended in 50 μL of 1X NEBuffer 2 containing 0.1 mM dATP and 25 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M), and incubated at 37°C for 30 min ...
-
bioRxiv - Physiology 2024Quote: ... the following reagents were added to each tube containing 1 cell in ∼5 μL: 2 μL M-MuLV Reverse Transcriptase Reaction Buffer (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Physiology 2024Quote: ... Separate sets of cells were also collected and frozen in RIPA buffer containing 2 mM activated sodium orthovanadate (Na3VO4) (New England Biolabs) and 1% protease inhibitor cocktail (MilliporeSigma ...
-
bioRxiv - Molecular Biology 2024Quote: ... 50 µL reactions were prepared by mixing 25 µL of 2× Phusion High-Fidelity PCR Master Mix (New England Biolabs), 5 ng of purified library plasmid DNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... The new SNAP-tagged histones synthesized during the chase were fluorescently labelled with 2 μM of the red-fluorescent reagent SNAP-cell TMR star (New England Biolabs) during a 15 min-pulse step followed by 30 min wash in fresh medium ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were grown on glass coverslips and pre-existing SNAP-tagged histones were fluorescently labelled with 2 μM of the red-fluorescent reagent SNAP-cell TMR star (New England Biolabs) during a 30 min-pulse step followed by 30 min wash in fresh medium ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were grown on glass coverslips and SNAP-tagged histones were fluorescently labelled with 2 μM of the red-fluorescent reagent SNAP-cell TMR star (New England Biolabs) during a 30 min-pulse step ...
-
bioRxiv - Molecular Biology 2024Quote: ... The resulting oligoduplex was ligated into a target plasmid vector predigested with BsmBI (55 °C for 2 h) using T4 DNA ligase (NEB). Cloning reactions were transformed into chemically competent NEB Turbo E ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 µg of RNA was reverse transcribed using the ProtoScript II Reverse transcriptase kit from New England Biolabs (NEB #M0368S) and primed with oligo dT ...
-
bioRxiv - Microbiology 2024Quote: ... and 1U RNasin) for 2 hours at 30°C and then incubated with 100 μL of Streptavidin Magnetic Beads (NEB) for 30 min at room temperature ...
-
bioRxiv - Biophysics 2024Quote: ... was obtained as previously described.2 Mutagenesis to produce additional isoforms and mutants was performed using the Q5 Site Directed Mutagenesis Kit (New England Biolabs). 1N4R tau was generated using by an initial round of mutagenesis with primers (5’-CTGAAGAAGCAGGCATTGG-3’ and 5’-CTTCCGCTGTTGGAGTGC-3’ ...
-
bioRxiv - Genetics 2024Quote: ... The 24 μl of dA-tailed DNA and 2 μl of ligation adapter were ligated using 4 μl of Quick T4 DNA Ligase (New England Biolabs) in 40 μl of reaction volume ...
-
bioRxiv - Genomics 2024Quote: ... the bead array was put into a 1.5 mL centrifuge tube of 200 µL extension buffer (1x NEBuffer 2, 1mM dNTP, 25 units Klenow exo- (NEB M0212L)) ...
-
bioRxiv - Synthetic Biology 2024Quote: pDC011 variants with gRNAs that target the loci (Supplementary Table 2) were generated by Golden Gate assembly using AarI and T4 DNA Ligase (NEB). pDC011 is a derivative of pSL2680 (Ungerer & Pakrasi ...