Labshake search
Citations for New England Biolabs :
1701 - 1750 of 6717 citations for 6H 1 3 Dioxolo 4 5 g 1 benzopyran 6 one 7 8 dihydro since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2021Quote: ... 7 μg of ligated chromatin was digested with 10U specific second cutter NlaIII (R0125S, NEB) in 100 μl system with CutSmart Buffer (NEB) ...
-
bioRxiv - Biochemistry 2021Quote: ... 7 μL of the processing reaction products were treated with 10 units Quick CIP (NEB) in 1X CutSmart buffer (NEB ...
-
bioRxiv - Cell Biology 2022Quote: SLC25A46 was amplified through PCR with Taq-polymerase with 7-deaza GTP/nucleotide mix (NEB) using cDNA from control fibroblasts as a template and cloned into Gateway modified pBABE-Puro using Gateway Cloning Technology (Invitrogen) ...
-
Caspase cleavage of Influenza A virus M2 disrupts M2-LC3 interaction and regulates virion productionbioRxiv - Microbiology 2024Quote: ... Mutant segment 7 plasmids were generated through Q5 Site-Directed Mutagenesis Kit (New England BioLabs).
-
bioRxiv - Physiology 2020Quote: ... Membranes were washed with TBS-T and then incubated with an anti-rabbit horseradish peroxidase conjugated secondary antibody (New England Biolabs, 1:10,000 in 5% skim milk in TBS-T) for 2h ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 5′-cap was removed with RNA 5’ Pyrophosphohydrolase (Rpph, NEB), and the 5′-hydroxyl group was repaired with T4 polynucleotide kinase (BioLabs) ...
-
bioRxiv - Genomics 2020Quote: RNA 5’ pyrophosphohydrolase (RppH; 5 U/µL) (NEB, cat. no. M0356S)
-
bioRxiv - Molecular Biology 2021Quote: ... the 5’-cap was removed with RNA 5’ pyrophosphohydrolase (Rpph, NEB), after which 5’end was repaired with T4 polynucleotide kinase (NEB) ...
-
bioRxiv - Genomics 2022Quote: ... 5 μl of 5mM dNTPs containing 5-methyl-dCTP (N0356S, NEB) instead of dCTP ...
-
bioRxiv - Genomics 2023Quote: ... 5 μL of Digestion-2 mix (NdeI (5 U, NEB, R0111L) and/or BglII (5 U ...
-
bioRxiv - Cancer Biology 2021Quote: ... 6 µL of 20 mg/mL BSA (New England Biolabs) and 3.5 µL of 5 Weiss U/µL T4 DNA Ligase (ThermoFisher) ...
-
bioRxiv - Biochemistry 2022Quote: ... The supernatant was applied to 6 ml amylose resin (NEB) at 4 °C ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 6 U SalI (New England Biolabs, Cat. No. R0138S)) were incubated with the following condition ...
-
bioRxiv - Molecular Biology 2021Quote: ... 500 ng total RNA in a volume of 9 μl was ligated to 1 μl custom adapter mix (18S:28S ratio 1:2) using 1.5 μl T4 DNA ligase (New England Biolabs) in NEB next Quick ligation buffer (3 μl ...
-
bioRxiv - Cell Biology 2022Quote: ... mixed with 10 μl of lysis buffer (10 mM Tris-HCl [pH 8.8], 1 mM EDTA, 25 mM NaCl, 1% SDS and 8U/ml Proteinase K, NEB) for 3 min at room temperature ...
-
bioRxiv - Genomics 2019Quote: ... and resuspended in 198 µL A-tailing solution (1× NEB buffer 2, 500 mM dATP, 1% Triton X-100). DNA ends were A-tailed by adding 1.5 µL Klenow (exo- ...
-
bioRxiv - Genomics 2019Quote: ... The embryos were treated with protease (1 µL of 25 µg/µL Qiagen Protease, 1 µL of 10x NEB Buffer 4 ...
-
bioRxiv - Genomics 2020Quote: ... 50 ng of DNA was incubated for 1 hour at 60 °C with 1 U BstUI and 0.5 uL 10x CutSmart buffer (New England Biolabs), in a total volume of 5.0 uL ...
-
bioRxiv - Biochemistry 2022Quote: ... Cleavage fragments were resolved by 0.8% agarose gel electrophoresis with 1 μL of 1 kb Plus DNA Ladder (NEB) and visualized by ethidium bromide staining ...
-
bioRxiv - Biophysics 2019Quote: ... Supplementary Table 1) was digested in 200 µl of 1 × CutSmart buffer using 100 units of BsaI-HF (NEB) and 100 units of DraIII-HF (NEB ...
-
Structure-guided glyco-engineering of ACE2 for improved potency as soluble SARS-CoV-2 decoy receptorbioRxiv - Biochemistry 2021Quote: ... proteins (2 mg mL-1) were incubated with 180000 U mL-1 PNGase F (New England Biolabs, Unites States) in PBS (pH 7.4 ...
-
bioRxiv - Microbiology 2021Quote: ... Chromosomal DNA (1 µg) was digested with 10 units (1 µl) of restriction enzyme AciI (New England Biolabs (NEB)) for one hour at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... Chromosomal DNA (1 µg) was digested with 10 units (1 µl) of restriction enzyme AciI (New England Biolabs (NEB)) for one hour at 37°C ...
-
bioRxiv - Bioengineering 2022Quote: ... 1 µL of 1 µM Cas9 Nuclease (diluted from 20 µM stock in 1X NEBuffer r3.1) (NEB; catalog # M0386T), and 1X NEBuffer 3.1 (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... while the ter region was amplified using the primer pair 3778_ter 1 qPCR fwd with 3778_ter 1 qPCR rev and the Luna Universal qPCR Master Mix (New England Biolabs). Quantification of the ori/ter ratio was performed using the the 2-ΔCT method as described [62].
-
bioRxiv - Molecular Biology 2023Quote: ... in a 10 μL reaction in buffer (50 mM Tris-HCl pH 7.5, 1 mM DTT, 1 U/μL RNase Inhibitor (NEB)) and incubated for 1 hour at 37°C ...
-
bioRxiv - Plant Biology 2023Quote: ... The PCR products were inserted into pET28a using restriction digestion and ligation with EcoR 1 and Sal 1 (NEB) sites.
-
bioRxiv - Plant Biology 2023Quote: ... The precipitates were eluted into 30μL 1×SDS loading buffer and detected using anti-Myc and anti-MBP antibody (1:5,000, New England Biolabs).
-
bioRxiv - Genetics 2023Quote: ... 12% PEG-8000, 1 mM dNTPs, 1 μM second strand synthesis primer (AAGCAGTGGTATCAACGCAGAGTGAATG, Sangon) and 0.125 U/μL Klenow exo- (BioLabs)) at 37 °C for 1 h with rotation ...
-
bioRxiv - Molecular Biology 2020Quote: ... the 3’ adapter was first ligated using 0.5 μl of 3’SR Adapter for Illumina (NEB-kit) added to 30 ng of input RNA diluted in 3.0 μl nuclease free H2O ...
-
bioRxiv - Plant Biology 2021Quote: ... The antisense strand with a 3′ phosphate was radiolabeled by T4 Polynucleotide Kinase (3’ phosphatase minus) (NEB) and [γ-32P]ATP ...
-
bioRxiv - Molecular Biology 2020Quote: ... A slurry of protein A or G magnetic beads (NEB) was used to capture enriched chromatin ...
-
bioRxiv - Cell Biology 2020Quote: ... 75 µl of protein G magnetic bead suspension (S1430, NEB) pre-equilibrated in lysis buffer was added to each tube and incubation continued for additional 1 h at +4□C ...
-
bioRxiv - Microbiology 2024Quote: ... 50 μL of protein G beads (New England Biolabs (NEB), S1430S ...
-
bioRxiv - Microbiology 2024Quote: ... 50 μL of protein G beads (New England Biolabs (NEB), S1430S ...
-
bioRxiv - Genomics 2019Quote: ... and 4 U MmeI (NEB) for 2 h at 37 °C ...
-
bioRxiv - Genomics 2022Quote: ... 6.25x NEBuffer 4 (NEB, B7004S)) was added to each well ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 4 mM SAM (NEB). RNAs were then purified with the RNA Clean and Concentrator-5 Kit (Zymo) ...
-
bioRxiv - Genomics 2023Quote: ... 1.5 μL NEBuffer 4 (NEB), 0.75 μL T4 Phage β-glucosyltransferase (NEB M0357S) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 µg of total RNA was incubated with 5 μM oligo-(dT)-anchor (5’GCGAGCTCCGCGGCCGCGTTTTTTTTTTTT3’) and 5 U of Klenow polymerase (New England Biolabs) for 1 h at 37°C for template extension of the poly(A ...
-
bioRxiv - Molecular Biology 2021Quote: ... Mpe1 and one of the polymerase module genes were cloned into a SwaI (NEB) digested pBig1a vector of a modified biGBac system (Hill et al. ...
-
bioRxiv - Genomics 2019Quote: ... at room temperature for one hour and then transformed into NEB10 competent cells (NEB). Plasmids from independent colonies were isolated using a plasmid DNA minikit and Sanger sequenced to identify correctly inserted clones.
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR was performed using the Luna Universal One-Step RT-qPCR Kit (NEB) in an Applied Biosystems QuantStudio 3 thermocycler ...
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCR was performed using the Luna Universal One-Step RT-qPCR Kit (NEB) in an Applied Biosystems QuantStudio 7 thermo-cycler ...
-
bioRxiv - Systems Biology 2022Quote: ... PCRs were performed using the Luna® Universal One Step RT-qPCR Kit (NEB) in a ThermoFisher Quantstudio 3 instrument ...
-
bioRxiv - Microbiology 2022Quote: ... One reaction of NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB #E7645) was used for 1 μg genomic DNA input ...
-
bioRxiv - Cell Biology 2019Quote: ... one was treated with 400U Lambda protein phosphatase (Lambda PP, New England Biolabs, #P0753S) in 50µl phosphatase assay buffer ...
-
bioRxiv - Plant Biology 2020Quote: ... One microgram of total RNA was then treated with DNase I (New England Biolabs) prior to the first-strand cDNA synthesis using AffinityScript RT-qPCR cDNA synthesis kit (Agilent Technologies) ...
-
bioRxiv - Genomics 2020Quote: ... and 1µl cDNA in 25µL reactions with One Taq DNA polymerase (New England Biolabs). Amplicons were examined under UV light on 1% agarose gels stained with ethidium bromide ...
-
bioRxiv - Genomics 2022Quote: ... samples were diluted one in two before adding 4,000 U T4 DNA ligase (NEB) for overnight incubation at 16°C ...