Labshake search
Citations for New England Biolabs :
1701 - 1750 of 2971 citations for 6 AMINO 3 HYDROXY PYRIDO 2 3 B PYRAZINE 2 CARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2019Quote: ... the samples were added to 2 μL of second-strand synthesis mix (2.5× NEB buffer 2 [New England Biolabs] ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were labeled for 15 min with 2 μM TMR-Star (New England Biolabs) in complete medium for pulse labeling ...
-
bioRxiv - Molecular Biology 2020Quote: ... PNK was used to dephosphorylate RNA for 2 hours (New England Biolabs, Ipswich, MA) followed by heat-inactivation ...
-
bioRxiv - Molecular Biology 2020Quote: ... Resulting PCR amplicons were denatured and re-annealed in 1 × NEB buffer 2 (NEB) in a total volume of 9 μl using a following conditions ...
-
bioRxiv - Microbiology 2020Quote: ... SARS-CoV-2-bound proteins were eluted by adding 7.5 μl RNase H (NEB), 2 μl TURBO DNase (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2019Quote: 2 µg of genomic DNA was digested with 100 units of MspI (NEB R0106M) or TaqαI (NEB R0149M ...
-
bioRxiv - Genomics 2021Quote: ... 2 ul of the library was loaded using NEB loading dye (Cat: NEB #B7025) because it did not make a shadow on the gel as compared to the bromophenol blue dye ...
-
bioRxiv - Microbiology 2020Quote: ... Chromatin was digested overnight (ON) with either 2 μl (100 U) Dpn II (NEB) (later experiments ...
-
bioRxiv - Biochemistry 2020Quote: ... the DNA template was digested with 2 units of DNase I (New England Biolabs) for 1 h at 37 °C and the RNA was desalted twice by Illustra Microspin G-25 columns (GE Healthcare Life Sciences) ...
-
bioRxiv - Developmental Biology 2020Quote: ... and then digested by 2 U of T7 endonuclease I (T7E1, New England BioLabs) at 37 °C for 15 min ...
-
bioRxiv - Cell Biology 2020Quote: The pIGLR-2∷mCherry construct was generated with a Gibson assembly cloning kit (NEB) with the following four fragments ...
-
bioRxiv - Biochemistry 2020Quote: ... the supernatant was collected and passed through a 2 mL Amylose resin (NEB E8021S) pre-equilibrated with lysis buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... The reverse transcriptase linker was then ligated with T4 RNA Ligase 2 truncated (NEB) and reverse transcribed using M-MLV RNase H minus (Promega) ...
-
bioRxiv - Biophysics 2021Quote: ... was generated by subcloning Mdn1 aa4381-4717 into pSNAP-tag(T7)-2 (NEB N9181S) downstream of the SNAP tag ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 and cloned into pET28a using T4 DNA ligase (New England Biolabs GmbH, Germany). The gene encoding ribose-phosphate pyrophosphokinase (RPPK ...
-
bioRxiv - Bioengineering 2022Quote: ... Samples requiring dephosphorylation were treated with 2 U/μL λPP (New England Biolabs, # P0753) for 3 h at 30°C and then washed with PBSCM ...
-
bioRxiv - Cancer Biology 2022Quote: ... DNase I (2 µL, 2,000 U/ml, RNase-free, New England Biolabs, Ipswich, MA), 10× DNase buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... and inserted into the pGLuc Mini-TK 2 Gaussia luciferase enhancer reporter plasmid (NEB) via KpnI/SacI restriction sites ...
-
bioRxiv - Neuroscience 2022Quote: ... and nuclei were resuspended in 2 mL 1x NEBuffer 3.1 (New England Biolabs; B7203S) + 20uL NxGen RNase Inhibitor.
-
bioRxiv - Molecular Biology 2022Quote: ... were ligated to dephosphorylated RNAs using T4 truncated RNA ligase 2 (K227Q) (NEB, #M0351L). Unligated linkers were depleted by using 5 U per sample of 5’ deadenylase (NEB ...
-
bioRxiv - Microbiology 2022Quote: ... Secondary amplification reactions were performed using NEBNext high-fidelity 2 PCR master mix (NEB) in 50 μl reactions (26 μl of 2X mix ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 μL of a mix containing 5 U of T4 RNA Ligase 2 (NEB), 1 mM ATP ...
-
bioRxiv - Molecular Biology 2023Quote: ... The reaction with T4 RNA ligase 2 was performed in 1x T4 Rnl2 (NEB) supplemented with PEG 8000 (10% ...
-
bioRxiv - Microbiology 2023Quote: ... the RNA samples were treated using 2 units of DNase I (New England Biolabs) according to the manufacturer’s instructions to eliminate residual gDNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... or NEBNext Ultra II DNA Library Prep Kit for Illumina (replicate 2: NEB, E7645S), according to the manufacturers’ protocols ...
-
bioRxiv - Plant Biology 2023Quote: ... 2 μL of 10x T4 DNA Ligase Buffer with 10 mM ATP (NEB, B0202S), 1 μL of PaqCI/AarI activator (5 pmol ...
-
bioRxiv - Physiology 2023Quote: ... for every 2 µg of fusion protein in 1X TEV buffer (Catalog P8112S, NEB) for 16h at 30°C.
-
bioRxiv - Cell Biology 2023Quote: ... The eluted sample was incubated with 2 ml amylose resin (New England Biolabs, E8021L) for 1 h at 4°C ...
-
bioRxiv - Bioengineering 2022Quote: ... 10 μL PCR reactions were set-up using 2 μL 5x HF Buffer (NEB), 0.5 μL 10 mM dNTPs (NEB) ...
-
bioRxiv - Biophysics 2023Quote: ... 2 pmol were digested to single nucleosides using the Nucleoside Digestion Mix (NEB # M0649), and the ratio of Ψ s versus uridines was determined via tandem quadrupole mass spectrometry (Supplementary Figure S2a).
-
bioRxiv - Microbiology 2023Quote: ... 20-μL reactions contained 2 μM enzyme and 250 μM NTPs (New England BioLabs) in reaction buffer with 50 mM Tris-HCl (pH 7.5) ...
-
bioRxiv - Developmental Biology 2023Quote: ... On-Bead 5’ Decapping reaction was done using NEBuffer 2 buffer (NEB, B7002S ®). Off-Bead Reverse Transcription followed the instructions in SuperScript ® IV Reverse transcriptase kit ...
-
bioRxiv - Microbiology 2023Quote: ... The annealed constructs were ligated using 2 µL T4 RNA ligase2 (NEB, 10U/µL), 3 µL 0.1% BSA (Ambion) ...
-
bioRxiv - Molecular Biology 2023Quote: ... two pairs of oligonucleotides (Suppl. Table 2) were phosphorylated and ligated into BsbI (NEB) digested pDG459 plasmid ...
-
bioRxiv - Molecular Biology 2023Quote: ... a pair of oligonucleotides (Suppl. Table 2) was phosphorylated and ligated into BsbI (NEB) digested pX459 and pX458 plasmids ...
-
bioRxiv - Biophysics 2023Quote: ... 11 uL Exonuclease I Buffer and 2 uL Exonuclease I (New England Biolabs; M0293S) was added following reverse transcription and incubated at 37 °C for 15 min ...
-
bioRxiv - Genomics 2023Quote: ... 20 of 2 U µL-1 Phusion High-Fidelity DNA Polymerase (New England Biolabs), 160 µL of 40 U µL-1 Taq DNA ligase (New England Biolabs ...
-
bioRxiv - Genomics 2023Quote: ... Forked adapters (Supplementary Table S7) were annealed in NEBuffer 2 1X (NEB cat. B7002S) to a final concentration of 20 µM in a thermal cycler set to heat at 98°C and gradually cool down to 4°C with a 1°C per 20 sec gradient.
-
bioRxiv - Genomics 2023Quote: ... 0.4 μL RNase Inhibitor and 2 μL Induro RT (200 U/μL; NEB M0681S) were incubated for 15 minutes at 60°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 20 µL of reactions were treated with 2 µL DNase I (NEB, Cat # M0303S) in a total volume of 100 µL at 37°C for ∼ 20 min before further analysis and treatment.
-
bioRxiv - Immunology 2023Quote: ... and 2 µL of home-made Gibson mix (T5 exonuclease (0.2U; New England Biolabs), Phusion polymerase (12.5U ...
-
bioRxiv - Developmental Biology 2024Quote: ... R0148S)2 or the wild-type allele was digested with HphI (New England Biolabs, R0158S) for 1 hour ...
-
bioRxiv - Genomics 2024Quote: ... and mixed with an equal volume of 2 x RNA loading dye (NEB, B0363S). 25 μl of the mixture was loaded on a 10% TBE-Urea gel (Bio-Rad ...
-
bioRxiv - Cell Biology 2024Quote: ... all kinases were tested for activity using 2 µg each of histone H1 (NEB) or Myelin Basic Protein (MBP ...
-
bioRxiv - Genomics 2021Quote: ... and washed 3 times with ice-cold 10 mM Ribonucleoside Vanadyl Complex (RVC) (New England BioLabs, cat.no. S1402S, Ipswich, Mass, USA) in buffer A (10 mM NaCl ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 10 µl was mixed with 40 µL of 1x NEBuffer 3 supplemented with 10 mM MgCl2 and 5 units of Mbo I (New England BioLabs #R0147L). This reaction was incubated for 1 hour at 37°C ...
-
bioRxiv - Genetics 2021Quote: ... including 8 bp barcode and P5 overhang (5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCATCTTTGTGGAAAGGACGAAA CACCG-3’) using the Q5 Hot Start High-Fidelity polymerase (NEB #M0494S) for 22-24 cycles ...
-
bioRxiv - Molecular Biology 2021Quote: Telomeric duplex DNA 5′-GGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGCCCCTC-3′ and antisense (5′-GAGGGGCCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCC-3′ was end-labeled with [γ-32P]ATP (Amersham Biosciences) and T4-polynucleotide kinase (New England BioLabs) and purified from free nucleotides through G25 spin columns (GE Healthcare) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3’UTRs were combined to the TagRFP-T CDS using the Gibson assembly Master Mix (Cat#E2611, New England BioLabs Inc). The resulting fragment was then amplified via PCR and digested prior ligation into a vector containing only Hofstenia promoter region ...
-
bioRxiv - Cell Biology 2022Quote: ... The mixture was incubated for 3 days at 37 °C in the dark for conjugation and purified for 3 rounds using Monarch® PCR & DNA Cleanup Kit (5 μg) (Cat# T1030S, NEB) following the manufacturer’s instructions ...