Labshake search
Citations for New England Biolabs :
1601 - 1650 of 10000+ citations for Pig Glucagon Like Peptide 2 GLP 2 CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... Dephosphorylation of CRL4B took place in a 100 μl reaction mixture containing 86 μl of CRL4B protein (at 0.8 mg/ml) with 2 μl λ-phosphatase (λ-PP) in the presence of 0.1 mM MnCl2 and 1x PMP reaction buffer (NEB). Untagged-CRL4 complexes (4A ...
-
bioRxiv - Cell Biology 2022Quote: ... the sequence encoding amino acids 1-490 was amplified with NdeI and EcoRI overhangs and inserted into a modified backbone based on pSNAP-tag(T7)2 (NEB #N9181S) before a SNAPf-EGFP-6His tag (Budaitis et al. ...
-
bioRxiv - Plant Biology 2022Quote: ... The transformation vector pICU2:Cas9-dsRED containing the Cas9 gene from Streptococcus pyogenes expressed under the promoter of the Arabidopsis Incurvata 2 gene (ICU2, At5g67100) was combined with the gRNA combinations by Gibson assembly (NEB, USA). For RPB1 ...
-
bioRxiv - Plant Biology 2022Quote: ... including the stop codon and (2) the CDS and native promoter region 1024 bp upstream using Phusion High Fidelity DNA polymerase (NEB, USA) and TA-ligated into the entry vector pCR8/GW/TOPO (Thermo ...
-
bioRxiv - Molecular Biology 2023Quote: ... Beads were next resuspended in 1X Thermo Pol Buffer and treated with 2 µL RNA 5’ Pyrophosphohydrolase (New England Biolabs M0356) at 37°C for 1 h to promote decapping of 5’ RNA ends ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The cDNAs were subcloned into vectors through conventional ligation with Ligation high Ver.2 (Toyobo, Japan) or NEBuilder HiFi DNA Assembly (New England Biolabs, MA) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... The biotin handle and cosmid-I95 DNA were both digested for 2 h at 37 °C with SpeI-HF (New England Biolabs, R3133L) and subsequently heat-inactivated for 20 min at 80 °C ...
-
bioRxiv - Biochemistry 2024Quote: ... 125 μg of λ-phage DNA was mixed with two oligos (2 μM oligo Lab07 (/5Phos/AGG TCG CCG CCC/3BioTEG) and 2 μM oligo Lab06 (/5Phos/GGG CGG CGA CCT/3BioTEG) in 1× T4 DNA ligase reaction buffer (NEB B0202S) and heated to 70°C for 15 min followed by gradual cooling to 15°C for 2 hours ...
-
bioRxiv - Biophysics 2023Quote: Tau was phosphorylated in vitro according to previous protocols with some modifications.12,88 50 µL of 100 µM tau was incubated with 2 µg cAMP-dependent Protein Kinase (PKA, New England BioLabs P6000S) and/or 0.4 µg GSK3β (Sigma-Aldrich G4296 ...
-
bioRxiv - Cancer Biology 2024Quote: ... followed by PCR amplification of the BC-sgRNA1-sgRNA2 region from 32 μg of bulk lung genomic DNA using Q5 Ultra II High-Fidelity 2× Master Mix (New England Biolabs, M0494X). Unique dual-indexed primers were used to amplify each sample followed by purification using Agencourt AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Cell Biology 2024Quote: ... Eluted RNA was treated with T4 PNK and preadenylated linker was ligated to the 3’ end using T4 RNA ligase 2 truncated KQ (NEB, M0373L). Linker-ligated RNA was reverse transcribed with Protoscript II (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2.5 uL each 10 uM forward and reverse primers (cTF223, cTF218 - see Supp. Table 2) and 25 uL NEBNext Q5U Master Mix (NEB, M0597) and ran the following thermocycling protocol ...
-
bioRxiv - Molecular Biology 2023Quote: Internally fluorescein-labelled RNA was produced by ligation of in vitro transcribed 5′ acceptor RNA fragment with chemically produced 3′ donor RNA containing internal fluorescein dT modification and 5′ monophosphate essential for ligase activity using T4 Ligase 2 (NEB #M0239S). Additionally ...
-
bioRxiv - Neuroscience 2024Quote: ... A 5’-adenylated DNA adapter (5’-rAppAGATCGGAAGAGCACACGTCT-NH2-3’) was added to 3’-ends using truncated T4 RNA ligase 2 (New England Biolabs; M0242S). After ligation of the 5’-RNA adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC-3’ ...
-
bioRxiv - Cell Biology 2024Quote: The plasmids used in this study were obtained from the sources as noted in Table 2 or made by either restriction digest and ligation or PCR and NEBuilder HiFi DNA assembly (New England Biolabs E5520S). Insert sequences were ordered as custom GeneBlocks from IDT or isolated from existing plasmids ...
-
bioRxiv - Genomics 2024Quote: ... Amplicons were then barcoded for NGS by combining 2 µL of amplicon from the previous PCR with 1X Q5 High-Fidelity Master Mix (New England Biolabs M0492) and 500 nM forward and reverse indexing primers (Integrated DNA Technologies) ...
-
bioRxiv - Microbiology 2024Quote: ... were digested with NotI and the wc-1 and wc-2 fragments were cloned into the respective plasmids with NEB HiFi DNA assembly mastermix (NEB, US). This resulted in the prey plasmid wc-1-pMB29 and bait plasmid wc-2-pMB28 ...
-
bioRxiv - Developmental Biology 2023Quote: ... 0.5XSSC in H2O) on a light table for 1 hour and treated with 2 μg/mL Protease K (NEB, Cat PB107S) in PBS containing 0.3% Triton-X for 10 minutes followed by post-fixation in 4% PFA for 10 minutes ...
-
bioRxiv - Developmental Biology 2023Quote: ... the tbb-2 3’UTR sequence was amplified from genomic DNA using PCR and primers 5’-tggatgaactatacaaatagatgcaagatcctttcaagca-3’ and 3’-aggttttcaccgtcatcacccgcgaaaaacccatgtaagt-5’ and the vector containing the sequence of pie-1p::his-15::gfp amplified from plasmid containing pie-1p::his-15::gfp::egg-6 3’UTR using PCR and primers 5’-ggtgatgacggtgaaaacct-3’ and 3’-ctatttgtatagttcatccatgcc-5’ were used to generate pie-1p::his-15::gfp::tbb-2 3’UTR by using Gibson assembly (NEB E2611). To add the wild type or mutant 3xmir-51 seed sequences ...
-
bioRxiv - Pathology 2023Quote: ... cDNA then was used as a template for barcoding PCR following ONT’s protocol (SQK-LSK110 with EXP-PBC096) and LongAmp Taq 2× Master Mix (NEB, Ipswich, MA). The barcoded amplicons were bead purified at a 0.8× beads:solution ratio before being pooled by equal volume with libraries from unrelated samples and a library generated from HeLa RNA (ThermoFisher)
-
bioRxiv - Molecular Biology 2022Quote: ... pHAGE lentiviral plasmids encoding the six other HCoV N-EGFP were generated by replacing SARS-CoV-2 N with the respective HCoV N sequences by PCR (New England Biolabs M0492S) and NEBuilder HiFi DNA Assembly (New England Biolabs E2621S) ...
-
bioRxiv - Neuroscience 2023Quote: ... the coverslips were washed in 2×SSC for 30 minutes for a total of four washes and then stored at 4°C in 2×SSC supplemented with 1:100 Murine RNase inhibitor (New England Biolabs, M0314S) for no longer than 2 weeks prior to imaging.
-
bioRxiv - Genomics 2023Quote: Library oligos for the MYC enhancer screen were synthesized by Twist Bioscience and amplified using the NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L), forward primer ...
-
bioRxiv - Genomics 2023Quote: ... thirty 20 μl ePCRs were performed using 400 ng of DNA for each reaction and NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541S) with the following primers ...
-
bioRxiv - Biophysics 2023Quote: ... These plasmids were digested with NotI-HF and XhoI for 2 h at 37°C (R3189, R0146, New England Biolabs, UK) and heat-inactivated for 20 min at 80°C.
-
bioRxiv - Genetics 2023Quote: Library oligos for the prime editing screen were synthesized by Twist Bioscience and amplified using the NEBNext High-Fidelity 2× PCR Master Mix (NEB M0541L) with the forward primer GTGTTTTGAGACTATAAATATCCCTTGGAGAAAAGCCTTGTTT and the reverse primer CTAGTTGGTTTAACGCGTAACTAGATAGAACCGCGGTGTTAGG ...
-
bioRxiv - Genomics 2023Quote: ... cells were then pelleted at 500xg for 2 min at 4°C and then resuspended in 200 μl of 1 × T4 DNA ligase buffer (NEB, B0202S) containing 0.2% SDS ...
-
bioRxiv - Cell Biology 2022Quote: ... The mutant fragments were amplified by high-fidelity DNA polymerase 2 × Phanta Max Master Mix followed by DpnI (New England BioLabs; R0176S) digestion in 37°C for 1 hour to eliminate the templates ...
-
bioRxiv - Genetics 2023Quote: ... PCR products were analyzed on 2% Agarose gels with 0.5 ng/L Ethidium bromide using a 1kb Plus DNA Ladder (New England BioLabs Cat # N3200S) for size reference ...
-
bioRxiv - Genetics 2022Quote: ... and 2 μg of DNA was digested with 50 units of NlaIII and 5 μL CutSmart® Buffer (NEB, cat #R0125L), in a total volume of 50 μL ...
-
Striated muscle-specific base editing enables correction of mutations causing dilated cardiomyopathybioRxiv - Genetics 2022Quote: ... RT-PCR or qPCR was performed with 1 μl of 1:2 diluted cDNA using the Q5®Hot Start High-Fidelity 2X Master Mix (NEB) or the SYBR™ Green PCR Master Mix (ThermoFisher) ...
-
bioRxiv - Biochemistry 2023Quote: ... was used to linearize plasmid (10 µg) by incubating at 37 °C for a minimum of 2 hours in 1x CutSmart buffer (NEB, B7204S). Linearized plasmid was purified by extraction with an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1 ...
-
bioRxiv - Developmental Biology 2023Quote: ... The 2-kpb cbln12 promoter (Dohaku et al., 2019) and lTl-Kaede-pAS were subcloned to pT2ALR-Dest by NEBuilder (NEB, USA). To generate Tg(5xUAS-hsp70l:HA-skor2-P2A-mCherry ...
-
bioRxiv - Plant Biology 2023Quote: ... and PEP444c were amplified using a cDNA template obtained from 2-week-old barley shoots and roots and Q5® High-Fidelity DNA Polymerase (New England BioLabs) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... The cDNAs were diluted 1:10 and 2 μl of each used for subsequent PCR reactions with one unit of Taq polymerase (New England Biolabs, MA), 200uM dNTPs (New England Biolabs ...
-
bioRxiv - Developmental Biology 2023Quote: One-cell stage zebrafish embryos were injected with 1-2 nl of injection solution containing 300 ng/μl of Cas9 enzyme (NEB# M0646T) and 12.5 ng//μl of sgRNA ...
-
bioRxiv - Microbiology 2023Quote: ... Amplification of target genes was carried out using a SYBR Green based qPCR mix consisting of Q5® High-Fidelity 2× Master Mix (NEB), SYBR Green ...
-
bioRxiv - Genomics 2023Quote: ... The gDNA is eluted with 25.2uL ddH2O and undergoes a second round of in vitro CpG methylation with previously described parameters above with exception that 10x Mg2+-free buffer is replaced with equal volume of NEB Buffer #2 (New England Biolabs, B7002S). The reaction is incubated again for 4 hours at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... Reactions were performed at 37°C for the indicated time (30 min if not otherwise specified) and then terminated by the addition of 10 μL of 2× RNA loading dye (New England Biolabs, USA). Reaction samples were heated at 85°C for 2 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... Oligos for side 1 and 2 were dimerized separately by mixing 9 μl of OligoA at 100 μM with 9 μl of OligoB at 100 μM and 2 μl of 10x DNA Ligase Buffer (NEB, M0202S) and heating to 95 °C for 5 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... 14-3-3ζ with different conjugated molecules and BAD variants conjugated with mCitrine were subcloned to the multiple cloning site (MCS-2) using EcoRI and XbaI (NEB; # R0145S) and the MCS-1 using MluI-HF (NEB ...
-
bioRxiv - Genomics 2023Quote: ... Eluted RNA was treated with T4 PNK and preadenylated linker was ligated to the 3’ end using T4 RNA Ligase 2 truncated KQ (NEB, M0373L).
-
bioRxiv - Synthetic Biology 2023Quote: ... and the targeted DNA region was amplified by PCR using the biomass as the template with the Q5™ High-Fidelity 2× master mix (New England Biolabs). Base-editing efficiency when targeting a plasmid-borne gene was estimated by isolating plasmid DNA upon 24-h editing treatment by using the NucleoSpin™ plasmid EasyPure kit (Macherey-Nagel ...
-
bioRxiv - Neuroscience 2023Quote: ... Final nuclear lysates were resuspended using 100 µl of resuspension solution (1x PBS + 2% BSA + 0.2U/µl RNase inhibitor - New England Biolabs, Cat#: M0314S). Hoechst staining was performed to assess the quality of isolated nuclei based on their shape ...
-
bioRxiv - Genetics 2024Quote: ... 250 ng of RNA samples were digested at 37°C for 2 hours with Nucleoside Digestion Mix (New England Biolabs, M069S). Digested RNA samples were diluted to 100 µl with double-distilled water and filtered through 0.22 µm Millex Syringe Filters ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... ddRAD library preparation included an initial digestion of 300 ng of DNA in a 34 μL reaction (2 hours at 37 °C; 10 U each of SbfI and MspI, New England Biolabs Inc.). Standard Illumina adapters were ligated using 60 cycles of digestion at 37 °C (2 minutes ...
-
bioRxiv - Neuroscience 2024Quote: ... and Gas5 shRNAs (shRNA # 1= G5C1 and shRNA # 2= G5C2) were cloned by replacing the existing Luciferase shRNA (shRLuc) under a U6 promoter using BamHI (NEB #R0136L) and EcoRI restriction sites (Table 3) ...
-
bioRxiv - Biochemistry 2024Quote: ... and ligated to pre-adenylated linkers (NI-810 to NI-815) containing 5 nt sample barcodes unique for each sample using truncated T4 RNA ligase 2 (K227Q) (NEB; M0351L). Ligated fragments were separated from free linkers on a 15% polyacrylamide TBE-Urea gel and then pooled and purified for reverse transcription using RT primer NI-802 and ProtoScript II Reverse Transcriptase (NEB ...
-
bioRxiv - Neuroscience 2024Quote: ... Final nuclear lysates were resuspended using 100 µl of resuspension solution (1x PBS, 2% BSA, 0.2U/µl RNase inhibitor; New England Biolabs, cat# M0314S). Hoechst staining was performed to assess the quality of isolated nuclei based on their morphology ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Standard Illumina adapters were ligated using 60 cycles of digestion at 37 °C (2 minutes) and ligation at 16 °C (4 minutes) with 400 U of T4 ligase (New England Biolabs, USA), followed by heat-inactivation at 65 °C (10 minutes) ...