Labshake search
Citations for New England Biolabs :
1601 - 1650 of 1892 citations for 6 FLUORO 2 TRIFLUOROMETHYLQUINOLINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... 2 µl preramp PCR product was mixed with 48 µl tagging PCR mix (10 µl 5x phusion HF buffer (NEB); 1 µl Phusion Hot Start II DNA Polymerase (2U/ µl ...
-
bioRxiv - Cancer Biology 2023Quote: ... The digested vector was combined with the amplified inserts in a 5:2 ratio by mass and ligated using a 2X Gibson Assembly Master Mix (NEB) at 50 °C for 30 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... and PCR amplified for 7-9 cycles depending on the samples using NEBNext High Fidelity 2× PCR master mix (New England Biolabs). The optimal cycle number was determined empirically each time by qPCR ...
-
bioRxiv - Cell Biology 2023Quote: ... Unbound material was removed by washing the samples 5x for 5min with head over head rotation at 4°C in wash buffer plus detergent (1x buffer XT, 1% digitonin, 2 mM PMSF and 10% glycerol) using a magnetic separator (New England Biolabs). Bound material was finally eluted with Biotin elution buffer (1x buffer Biotin XT elution ...
-
bioRxiv - Genomics 2023Quote: ... The sRNA 3’ Adaptor (5’/5rApp/ ATCTCGTATGCCGTCTTCTGCTTG /3ddC/) was ligated to the 3’-end of fragmented RNAs using truncated T4 ligase 2 (NEB), and the SRnA 5’ RNA adaptor (5’GUUCAGAGUUCUACAGUCCGACGAUC ...
-
bioRxiv - Genomics 2023Quote: ... were PCR-amplified (2 PCR reactions, 12 cycles) using Illumina adapter-specific primers and NEBNext Ultra II Q5 Master Mix (NEB). After library profile analysis by Agilent 2100 Bioanalyser (Agilent Technologies ...
-
bioRxiv - Plant Biology 2023Quote: ... and amplified using NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs Set 2, New England Biolabs, #E6442). After quality check with the Bioanalyzer High Sensitivity DNA assay (Agilent) ...
-
bioRxiv - Bioengineering 2023Quote: ... The reaction was incubated at 37 °C for 3 hours and stopped by adding 2 Units of DNase I (NEB), to digest the DNA templates and incubating at 37 °C for 15 minutes ...
-
bioRxiv - Microbiology 2023Quote: ... The reaction mix (2 μL) was then used to transform 25 μL of chemically competent 10-beta cells (C3019H; NEB), which were subsequently plated on Luria-Bertani (LB ...
-
bioRxiv - Immunology 2022Quote: ... Sample index PCR: 2 µl tagging PCR product was mixed with 18 µl PCR mix (4 µl 5x phusion HF buffer (NEB); 0.4 µl Phusion DNA Polymerase (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... was isolated from total RNA or crude cell lysates by 2 rounds of affinity chromatography using oligo d(T)25-derivatized magnetic beads (NEB). RNA yields were quantified by ultraviolet (UV ...
-
bioRxiv - Molecular Biology 2023Quote: Total SNAP-tagged histones were labeled by incubating cells with 2 µM of the red-fluorescent reagent SNAP-cell TMR-star (New England Biolabs) for 15 min before cell fixation ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were generated by 7-9 rounds of PCR amplification using NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L), purified using SPRIselect reagent kit (Beckman Coulter ...
-
bioRxiv - Biochemistry 2023Quote: ... Reactions with UDP-MurNAc-80mer RNA contained 2 µg RNA and products were purified using the Monarch RNA Cleanup Kit (NEB).
-
bioRxiv - Genetics 2023Quote: ... we treated the glands with 0.1% Triton X-100 for 2 minutes prior to adding 100 ug/mL RNase A (NEB #T3018L) and performed a 1 hour incubation at RT (24 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Samples were treated with DNase I (20 units) in the presence of RNase inhibitor at 300 U/ml in x1 buffer # 2 (NEB) at 37°C for 30 min ...
-
bioRxiv - Systems Biology 2023Quote: ... 25 mg of small RNA from the 12 diverse organs/tissues was resuspended in 10 mL of 1x GlycoBuffer 2 (NEB) and 7.5 mL PNGaseF (NEB) ...
-
bioRxiv - Cell Biology 2023Quote: ... Cell pellets were lysed directly in 8X the cell pellet volume with 2% SDS blue loading buffer (New England Biolabs), containing DTT ...
-
bioRxiv - Biophysics 2023Quote: ... and a reverse elongation primer (Supplementary Tables 1 and 2) and incubating for 1 cycle of annealing/extension with Q5 polymerase (New England Biolabs). dsDNA product was then incubated with ExoSAP-IT (Applied Biosystem ...
-
bioRxiv - Biophysics 2023Quote: ... primers with overlapping sequences (Supplementary Tables 1 and 2) were designed to generate point mutations with the NEBuilder HiFi DNA Assembly mix (New England Biolabs). Wild-type protein expression was performed in OverExpress C41 (DE3 ...
-
bioRxiv - Molecular Biology 2023Quote: ChIP-seq libraries were prepared with 2 ng of input or IP DNA using the NEBNext Ultra II DNA Library kit for Illumina (New England Biolabs). The quality of the libraries was assessed using the High Sensitivity DNA kit (Agilent ...
-
bioRxiv - Molecular Biology 2023Quote: ... sgRNA amplicons were generated by PCR of 2 ug genomic DNA per 100 ul reaction with Q5 2X Hot Start Master Mix (M0494L, NEB) and enough reactions to maintain 1000x screening sgRNA representation ...
-
bioRxiv - Molecular Biology 2023Quote: ... The cosmids were then digested for 2 hours at 37°C and heat-inactivated for 20 minutes at 80°C using SpeI-HF (New England Biolabs). Next ...
-
bioRxiv - Neuroscience 2023Quote: ... They were inserted into the linearized vector of pRVΔG-4mCherry from step 2 described above using HiFi DNA Assembly (NEB, USA). The HiFi reaction was mixed as described below:
-
bioRxiv - Genomics 2023Quote: ... followed by digestion to ribonucleotides by incubation for 2 h at 45 °C with 0.15 U of Nuclease P1 (NEB M0660S) in 10 mM ammonium acetate pH 5 ...
-
bioRxiv - Molecular Biology 2023Quote: The miRCat-33 3’ linker was ligated to the 3’ end of the RNAs on the Ni-NTA beads with 800 units of T4 RNA ligase 2 truncated K227Q (New England Biolabs) in 1 x PNK buffer / 16.67% PEG 8000 in the presence of 80 units RNasin in a total volume of 80 µl ...
-
bioRxiv - Genomics 2023Quote: ... mRNA was eluted from the oligo-dT beads and fragmented by incubating with the First Strand Synthesis Reaction buffer and Random Primer Mix (2×) from the NEBNext Ultra II Directional Library Prep Kit for Illumina (#NEBE7760; New England Biolabs) for 15Lmin at 94°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... was digested with BbsI enzyme and pre-annealed 5’-end phosphorylated sgDNA sequences (found in Extended file 2) inserted using Quick Ligase (New England Biolabs), and subsequently transformed into Stabl3 TM E ...
-
bioRxiv - Developmental Biology 2023Quote: ... for small RNA library preparation 50 to 300 ng of total RNA was ligated with randomized 3’ adapter using T4 RNA ligase 2 truncated KQ (NEB) in 1X T4 RNA ligase reaction buffer (NEB ...
-
bioRxiv - Developmental Biology 2023Quote: ... 50 nM of RCA primer, 1U/µL of RiboProtect (Blirt, #RT35) and 0.5 U/ µL of T4 RNA Ligase 2 (NEB, # M0239L). The ligation mix was introduced to the SecureSeal chamber and incubated on the samples for 2 hours at 37 degrees Celsius ...
-
bioRxiv - Bioengineering 2023Quote: ... Cells were washed two times in barcode wash buffer (+5 μM each of quenching oligo 1 & 2) and then resuspended in ice cold 1x ThermoPol reaction buffer (NEB) cells were passed through a 40μm strainer and counted ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 µL i7 unique index primer (10 µM) and 25 µL NEBNext® High-Fidelity 2X PCR Master Mix (NEB) and subjected to the following PCR program ...
-
bioRxiv - Cell Biology 2024Quote: ... we microinjected 5 ng/μl Pmyo-3::GFP and 95 ng/μl of 2-Log DNA ladder (New England BioLabs) into the germline of GRD-3::mKate2 animals to generate transgenics expressing a muscle-specific GFP marker.
-
bioRxiv - Cell Biology 2024Quote: ... Size-selected DNA fragments were amplified using NEB unique multiplexed i5 and i7 primers (E6440) in a total reaction volume of 100 µl together with 2 U Phusion High-Fidelity DNA Polymerase (NEB) and in the presence of 0.2 mM dNTPs and 1X Phusion High-Fidelity buffer ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA of 2×106 cells was extracted with the Monarch Total RNA Miniprep Kit with “on column” DNase I treatment (NEB). cDNA was generated by using LunaScript RT SuperMix Kit (NEB ...
-
bioRxiv - Cancer Biology 2024Quote: ... then split in 2 for PCR amplifications with either Minus or Plus primers using Q5 DNA Polymerase (New England Biolabs) with the following cycling conditions ...
-
bioRxiv - Molecular Biology 2024Quote: ... The ends of DNA were repaired by incubating in 70 μL of 1X NEBuffer 2 containing 0.6 units of T4 DNA polymerase (NEB, M0203S), 2 units of T4 polynucleotide kinase (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... Beads containing the repaired DNA were resuspended in 50 μL of 1X NEBuffer 2 containing 0.1 mM dATP and 25 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M), and incubated at 37°C for 30 min ...
-
bioRxiv - Neuroscience 2024Quote: ... Libraries were barcoded using NEBNext Multiplex Oligos for Illumina (Index Primers Set 1 and Set 2) (NEB, E7335S and E7500S). Paired end sequencing was performed (S1 and S2 ...
-
bioRxiv - Molecular Biology 2024Quote: ... or 2μg (dual-guide) per well were set up using the Q5 Hot Start High-Fidelity 2× Master Mix (NEB #M0494) in a total volume of 50μl ...
-
bioRxiv - Immunology 2024Quote: ... and this point mutation introduces a premature stop codon and abolishes an Hpy118I site and the line was genotyped by PCR (primers in Table 2) and Hpy118I digest (NEB) (Supp Fig 1B) ...
-
bioRxiv - Immunology 2024Quote: ... The irf8 st95 mutation abolishes an AvaI restriction site and this line was genotyped by PCR (primers in Table 2) and AvaI digest (NEB), as previously described (Shiau et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... The homology-directed repair (HDR) plasmid for C-terminal SAX-2::GFP(ju1831) was made using three-fragment Gibson Assembly (New England Biolabs) in which two sax-2 homology arms containing 498 bp upstream of the sax-2 TAA stop codon and 540 bp downstream of the sax-2 TAA stop codon plus the stop codon were amplified from N2 genomic DNA and fused such that they flanked GFP (pDD282) ...
-
bioRxiv - Microbiology 2024Quote: ... Diluted supernatants were used as the template DNA (5 μL) for qPCR using a 2×Luna universal qPCR master mix (New England BioLabs), with 0.5 μM of primers ...
-
bioRxiv - Biochemistry 2024Quote: ... The cDNA was diluted 1:50 in ddH2O and 2 µL used as a template in a 15 µL reaction using the Luna Universal qPCR Master Mix (NEB) on a Rotor-Gene Q (Qiagen) ...
-
bioRxiv - Microbiology 2024Quote: ... followed by excision and ligation for 2 hours at room temperature using the Instant Sticky-end Ligase Master Mix (NEB) in accordance with the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... The NEBuilder Assembly Tool was used to design primers for amplification of each component of the donor plasmid (Table 2) using Phusion (NEB); purified PCR products were assembled using NEBuilder HiFi DNA Assembly Master Mix (NEB) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purified extension products were denatured and ligated to adaptor 2 (Ad2, Supplementary Table 3) by Instant Sticky-end Ligase Master Mix (New England Biolabs) at 4 °C overnight ...
-
bioRxiv - Microbiology 2024Quote: ... The SARS-CoV-2 Spike coding region was then amplified using Q Hot Start High-Fidelity DNA Polymerase (New England Biolabs) with forward (5’ TCATCGATGCATGGTACGCCACCATGTTTGTTTTTCTTGTTTTATTG 3’ ...
-
bioRxiv - Microbiology 2024Quote: ... the RNA pellet was resuspended in 50 µl of RNase-free H2O and 1 µl of the resuspended samples was used for quantification of the DENV-2 D220 NS5 RNA regions using Luna Universal One-Step RT-qPCR Kit (New England Biolabs) in a 10-ul reaction volume ...