Labshake search
Citations for New England Biolabs :
1601 - 1650 of 3392 citations for 3RS 4 Dimethylamino 3 methyl 2 2 diphenylbutanenitrile Isodidiavalo since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... Deletion constructs were made by PCR amplification of the appropriate regions and cloned into the Cilantro 2 vector using Gibson cloning (New England Biolabs). Lentiviral particles carrying the respective constructs in the Cilantro 2 vector were produced and used to transduce MOLM-13 cells as described above ...
-
bioRxiv - Microbiology 2024Quote: ... The SARS-CoV-2 Spike coding region was then amplified using Q Hot Start High-Fidelity DNA Polymerase (New England Biolabs) with forward (5’ TCATCGATGCATGGTACGCCACCATGTTTGTTTTTCTTGTTTTATTG 3’ ...
-
bioRxiv - Microbiology 2024Quote: ... the RNA pellet was resuspended in 50 µl of RNase-free H2O and 1 µl of the resuspended samples was used for quantification of the DENV-2 D220 NS5 RNA regions using Luna Universal One-Step RT-qPCR Kit (New England Biolabs) in a 10-ul reaction volume ...
-
bioRxiv - Physiology 2024Quote: ... Separate sets of cells were also collected and frozen in RIPA buffer containing 2 mM activated sodium orthovanadate (Na3VO4) (New England Biolabs) and 1% protease inhibitor cocktail (MilliporeSigma ...
-
bioRxiv - Physiology 2024Quote: ... the following reagents were added to each tube containing 1 cell in ∼5 μL: 2 μL M-MuLV Reverse Transcriptase Reaction Buffer (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA of 2×106 cells was extracted with the Monarch Total RNA Miniprep Kit with “on column” DNase I treatment (NEB). cDNA was generated by using LunaScript RT SuperMix Kit (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 µg of RNA was reverse transcribed using the ProtoScript II Reverse transcriptase kit from New England Biolabs (NEB #M0368S) and primed with oligo dT ...
-
bioRxiv - Molecular Biology 2024Quote: ... 10 µg genomic DNA per sample was mock treated or treated with 2 U/µg DNA of RNaseH (NEB, M0297) for 2 h at 37 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 50 µL reactions were prepared for the second PCR by mixing 25 µL of 2× Phusion High-Fidelity PCR Master Mix (New England Biolabs), 15 µL of cleaned-up PCR product from the first PCR and 10 µL Nextera DNA CD Indexes (96-well format from Illumina ...
-
bioRxiv - Plant Biology 2024Quote: ... The OsXLG crRNA target sequences were amplified using gene-specific primers (SI, Table 2) and Q5 Hi-Fi DNA polymerase (NEB). The PCR amplicons were subjected to Sanger sequencing and analyzed using CRISP-ID online software (Dehairs et al. ...
-
bioRxiv - Microbiology 2024Quote: ... Site-directed mutagenesis was performed to engineer alanine or glutamic acid substitution mutations in Tax1bp1 using the primers listed in Table 2 and the Q5 site-directed mutagenesis kit (New England Biolabs). Open reading frames (ORFs ...
-
bioRxiv - Biophysics 2024Quote: ... We digested the pBS-parS for 2 h at 37°C using NotI-HF or XhoI restriction enzymes (New England Biolabs) and heat-inactivated for 20 min at 80°C ...
-
bioRxiv - Microbiology 2024Quote: ... and 1U RNasin) for 2 hours at 30°C and then incubated with 100 μL of Streptavidin Magnetic Beads (NEB) for 30 min at room temperature ...
-
bioRxiv - Genomics 2024Quote: ... the bead array was put into a 1.5 mL centrifuge tube of 200 µL extension buffer (1x NEBuffer 2, 1mM dNTP, 25 units Klenow exo- (NEB M0212L)) ...
-
bioRxiv - Genomics 2024Quote: ... with a final extension of 72°C for 2 min using Q5 Hot Start High-Fidelity DNA Polymerase (NEB M0493L). PCR reactions were purified by PCR cleanup beads (UC Berkeley DNA Sequencing Facility ...
-
bioRxiv - Genomics 2024Quote: ... 2 µL of 10X T4 Ligase Buffer and 1 µL of NEB Golden Gate Assembly Kit (NEB, catalog no. E1602L) with 65 cycles of digestion at 42°C and ligation at 16°C for 5 min each ...
-
bioRxiv - Biophysics 2024Quote: The extracted genomic DNA was then subjected to NGS library preparation through a two-step PCR process using Q5 High-Fidelity 2× Master Mix (New England Biolabs). The first PCR step involved amplifying the genomic loci and attaching adapter sequences (primers listed in Table S10) ...
-
bioRxiv - Synthetic Biology 2024Quote: pDC011 variants with gRNAs that target the loci (Supplementary Table 2) were generated by Golden Gate assembly using AarI and T4 DNA Ligase (NEB). pDC011 is a derivative of pSL2680 (Ungerer & Pakrasi ...
-
bioRxiv - Biophysics 2024Quote: ... was obtained as previously described.2 Mutagenesis to produce additional isoforms and mutants was performed using the Q5 Site Directed Mutagenesis Kit (New England Biolabs). 1N4R tau was generated using by an initial round of mutagenesis with primers (5’-CTGAAGAAGCAGGCATTGG-3’ and 5’-CTTCCGCTGTTGGAGTGC-3’ ...
-
bioRxiv - Biochemistry 2024Quote: ... 66 °C for 30 s, 72 °C for 30 s; and 72 °C for 2 min; Q5 Hot Start DNA polymerase [NEB]). PCR1 product was purified by SPRI beads (Mag-Bind TotalPure NGS ...
-
bioRxiv - Bioengineering 2024Quote: ... Cap-1 structures were then generated using the Vaccinia Capping System in conjunction with mRNA cap 2’-O-methyltransferase (both from New England Biolabs) for 45 minutes at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... then 30 μl denatured lysate were treated with 2 μl Endo H or 1 μl PNGase F enzymes (New England Biolabs) in 40 μl reactions according to the manufacturer instructions ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... libraries were amplified with NEBNext® Multiplex Oligos for Illumina® (Dual Index Primers Set 2) (New England Biolabs E7780) and KAPA HiFi HotStart ReadyMix (KAPA Biosystems KK2601) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... we obtained the methylated and non-methylated counts at individual CpG sites of the reference genome (hg38) in germline cells using genome-wide methylation data originating from NEBNext Enzymatic Methyl-seq (EM-seq; New England Biolabs, Ipswich, MA, USA) of flow- sorted spermatogenic cell types representing 4 different stages of spermatogenesis ...
-
bioRxiv - Molecular Biology 2021Quote: ... The bead slurry was directly treated with 3 µL Klenow (3’→5’ exo-) (NEB) in 50 µL NEB Buffer #2 with 0.2 mM ATP at 37 °C for 30 min to add 3’ overhangs to DNA ...
-
bioRxiv - Biophysics 2020Quote: ... and 3-biotin-GTP (NEB) and purified using MEGAclear ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 3 units of DNaseI (NEB) were added and the mixture was incubated at 37°C for 1 h.
-
bioRxiv - Microbiology 2020Quote: ... 3) NEB LongAmp (NEB M0287) and 4 ...
-
bioRxiv - Genetics 2020Quote: ... 3 μL exonuclease buffer (NEB) and 4 μL nuclease-free water (Ambion ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 µL Rnl2KQ (NEB M0373S), water to 30 µL ...
-
bioRxiv - Bioengineering 2022Quote: ... 3 μl USER Enzyme (NEB) was then incubated with size-selected ...
-
bioRxiv - Molecular Biology 2023Quote: ... Index Primers Set 3 (NEB). Amplified libraries were cleaned up using Sample Purification Beads (NEB ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 µL XmaI (NEB R0180S) was added to fragment chromatin ...
-
bioRxiv - Systems Biology 2024Quote: ... 3 µL USER enzyme (NEB) were added to each sample and incubated at 37°C for 15 min and followed by a purification with 50 µL AMPure XP beads according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... 3 μl USER Enzyme (NEB) was applied to size-selected ...
-
bioRxiv - Physiology 2024Quote: ... with 1x GlycoBuffer 3 (NEB), 5 μL of α1-2,4,6 fucosidase O (2U/μl ...
-
bioRxiv - Genomics 2024Quote: ... 3 µl 10x NEBuffer2 (NEB), and 18 µl ddH2O ...
-
bioRxiv - Developmental Biology 2024Quote: ... exonuclease and NEBuffer 3 (NEB) were added to the library before incubation at 37 °C for 1 h ...
-
bioRxiv - Bioengineering 2024Quote: ... and 3 (New England Biolabs) for multiplexing ...
-
bioRxiv - Biophysics 2021Quote: ... The Biotin-handle and Cosmid-I95 DNA were both digested for 2 hours at 37°C with SpeI-HF (NEB, R3133L) and subsequently heat inactivated for 20 minutes at 80°C ...
-
bioRxiv - Evolutionary Biology 2021Quote: 5’ adapter ligation was performed by adding 3 uL of 10uM 5’ adaptor (which was previously denatured by heating to 70 C for 2 minutes and placed on ice, NEB E7330L), 2 uL of 10X T4 RNA ligation buffer (NEB B0216L) ...
-
bioRxiv - Neuroscience 2021Quote: ... PCR products were run on 2% agarose gels and the Quick load 100pb DNA ladder (New England Biolabs Inc., Ipswich, MA) was used for fragment size visualization ...
-
bioRxiv - Molecular Biology 2021Quote: ... All these reactions were performed in a single step by adding 2 µL of enzyme mix (1 µL of Thermolabile USER II (New England Biolabs, M5508L), 0.5 µL of Exonuclease I (New England Biolabs ...
-
bioRxiv - Molecular Biology 2020Quote: ... The plug was equilibrated with 100 μl CutSmart buffer containing 5 mM DTT and 1 mM dATP for 1 hour at room temperature before incubation for 2 h at 37°C in another 100 μl of the same buffer containing 1 μl Klenow exo-(NEB M0212S) and 1 μl T4 PNK (NEB M0201S) ...
-
bioRxiv - Physiology 2020Quote: ... Germany) 1.5% agarose gel using purple gel loading dye and 2-Log DNA ladder (both New England Biolabs, Ipswich, MA, USA) at 80 V and 85 mA for 2h ...
-
bioRxiv - Biochemistry 2020Quote: ... Cross-links were reversed from eluted chromatin by adding 6 μL of 5 M NaCl and 2 μL Proteinase K (NEB; P8107S) and incubation overnight at 65°C ...
-
bioRxiv - Biochemistry 2020Quote: ... Beads were resuspended in 1 volume of buffer A / 300 mM NaCl / 2 mM MnCl2 / 1 mM DTT and incubated with λ protein phosphatase (NEB) at 50 U / mL for 1 hour at 23°C with agitation ...
-
bioRxiv - Microbiology 2021Quote: ... The amplification of bacterial DNA was achieved by targeting the V3–V4 region of 16S rRNA gene with 30 µL final volume containing 15 µL of 2× master mix (BioLabs, USA), 3 µL of template DNA ...
-
bioRxiv - Genomics 2021Quote: Restriction digestion was carried out by adding 25 μL of 10 ×NEBuffer 2 and 100 U of the MluCI restriction enzyme (NEB, R0538) and incubating for ≥2 hours at 37°C in a Thermomixer at 900 rpm ...
-
bioRxiv - Zoology 2021Quote: ... amplicons were analyzed by 1.5% agarose gel electrophoresis with ethidium bromide staining and using a DNA ladder marker (2 log, 100 bp, or 1 kb DNA ladder from New England Biolabs, USA). Expected PCR product sizes of the first step and nested PCR step were 514 and 148 bp ...