Labshake search
Citations for New England Biolabs :
1551 - 1600 of 1824 citations for IL 2 Rat HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... 2 µl preramp PCR product was mixed with 48 µl tagging PCR mix (10 µl 5x phusion HF buffer (NEB); 1 µl Phusion Hot Start II DNA Polymerase (2U/ µl ...
-
bioRxiv - Cancer Biology 2023Quote: ... The digested vector was combined with the amplified inserts in a 5:2 ratio by mass and ligated using a 2X Gibson Assembly Master Mix (NEB) at 50 °C for 30 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... and PCR amplified for 7-9 cycles depending on the samples using NEBNext High Fidelity 2× PCR master mix (New England Biolabs). The optimal cycle number was determined empirically each time by qPCR ...
-
bioRxiv - Cell Biology 2023Quote: ... Unbound material was removed by washing the samples 5x for 5min with head over head rotation at 4°C in wash buffer plus detergent (1x buffer XT, 1% digitonin, 2 mM PMSF and 10% glycerol) using a magnetic separator (New England Biolabs). Bound material was finally eluted with Biotin elution buffer (1x buffer Biotin XT elution ...
-
bioRxiv - Genomics 2023Quote: ... The sRNA 3’ Adaptor (5’/5rApp/ ATCTCGTATGCCGTCTTCTGCTTG /3ddC/) was ligated to the 3’-end of fragmented RNAs using truncated T4 ligase 2 (NEB), and the SRnA 5’ RNA adaptor (5’GUUCAGAGUUCUACAGUCCGACGAUC ...
-
bioRxiv - Genomics 2023Quote: ... were PCR-amplified (2 PCR reactions, 12 cycles) using Illumina adapter-specific primers and NEBNext Ultra II Q5 Master Mix (NEB). After library profile analysis by Agilent 2100 Bioanalyser (Agilent Technologies ...
-
bioRxiv - Plant Biology 2023Quote: ... and amplified using NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs Set 2, New England Biolabs, #E6442). After quality check with the Bioanalyzer High Sensitivity DNA assay (Agilent) ...
-
bioRxiv - Bioengineering 2023Quote: ... The reaction was incubated at 37 °C for 3 hours and stopped by adding 2 Units of DNase I (NEB), to digest the DNA templates and incubating at 37 °C for 15 minutes ...
-
bioRxiv - Microbiology 2023Quote: ... The reaction mix (2 μL) was then used to transform 25 μL of chemically competent 10-beta cells (C3019H; NEB), which were subsequently plated on Luria-Bertani (LB ...
-
bioRxiv - Immunology 2022Quote: ... Sample index PCR: 2 µl tagging PCR product was mixed with 18 µl PCR mix (4 µl 5x phusion HF buffer (NEB); 0.4 µl Phusion DNA Polymerase (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... was isolated from total RNA or crude cell lysates by 2 rounds of affinity chromatography using oligo d(T)25-derivatized magnetic beads (NEB). RNA yields were quantified by ultraviolet (UV ...
-
bioRxiv - Molecular Biology 2023Quote: Total SNAP-tagged histones were labeled by incubating cells with 2 µM of the red-fluorescent reagent SNAP-cell TMR-star (New England Biolabs) for 15 min before cell fixation ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were generated by 7-9 rounds of PCR amplification using NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L), purified using SPRIselect reagent kit (Beckman Coulter ...
-
bioRxiv - Biochemistry 2023Quote: ... Reactions with UDP-MurNAc-80mer RNA contained 2 µg RNA and products were purified using the Monarch RNA Cleanup Kit (NEB).
-
bioRxiv - Genetics 2023Quote: ... we treated the glands with 0.1% Triton X-100 for 2 minutes prior to adding 100 ug/mL RNase A (NEB #T3018L) and performed a 1 hour incubation at RT (24 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Samples were treated with DNase I (20 units) in the presence of RNase inhibitor at 300 U/ml in x1 buffer # 2 (NEB) at 37°C for 30 min ...
-
bioRxiv - Systems Biology 2023Quote: ... 25 mg of small RNA from the 12 diverse organs/tissues was resuspended in 10 mL of 1x GlycoBuffer 2 (NEB) and 7.5 mL PNGaseF (NEB) ...
-
bioRxiv - Cell Biology 2023Quote: ... Cell pellets were lysed directly in 8X the cell pellet volume with 2% SDS blue loading buffer (New England Biolabs), containing DTT ...
-
bioRxiv - Biophysics 2023Quote: ... and a reverse elongation primer (Supplementary Tables 1 and 2) and incubating for 1 cycle of annealing/extension with Q5 polymerase (New England Biolabs). dsDNA product was then incubated with ExoSAP-IT (Applied Biosystem ...
-
bioRxiv - Molecular Biology 2023Quote: ... The ends of DNA were repaired by incubating in 70 μL of 1X NEBuffer 2 containing 0.6 units of T4 DNA polymerase (NEB, M0203S), 2 units of T4 polynucleotide kinase (NEB ...
-
bioRxiv - Biophysics 2023Quote: ... primers with overlapping sequences (Supplementary Tables 1 and 2) were designed to generate point mutations with the NEBuilder HiFi DNA Assembly mix (New England Biolabs). Wild-type protein expression was performed in OverExpress C41 (DE3 ...
-
bioRxiv - Molecular Biology 2023Quote: ChIP-seq libraries were prepared with 2 ng of input or IP DNA using the NEBNext Ultra II DNA Library kit for Illumina (New England Biolabs). The quality of the libraries was assessed using the High Sensitivity DNA kit (Agilent ...
-
bioRxiv - Molecular Biology 2023Quote: ... sgRNA amplicons were generated by PCR of 2 ug genomic DNA per 100 ul reaction with Q5 2X Hot Start Master Mix (M0494L, NEB) and enough reactions to maintain 1000x screening sgRNA representation ...
-
bioRxiv - Molecular Biology 2023Quote: ... The cosmids were then digested for 2 hours at 37°C and heat-inactivated for 20 minutes at 80°C using SpeI-HF (New England Biolabs). Next ...
-
bioRxiv - Molecular Biology 2023Quote: ... Beads containing the repaired DNA were resuspended in 50 μL of 1X NEBuffer 2 containing 0.1 mM dATP and 25 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M), and incubated at 37°C for 30 min ...
-
bioRxiv - Neuroscience 2023Quote: ... They were inserted into the linearized vector of pRVΔG-4mCherry from step 2 described above using HiFi DNA Assembly (NEB, USA). The HiFi reaction was mixed as described below:
-
bioRxiv - Genomics 2023Quote: ... followed by digestion to ribonucleotides by incubation for 2 h at 45 °C with 0.15 U of Nuclease P1 (NEB M0660S) in 10 mM ammonium acetate pH 5 ...
-
bioRxiv - Molecular Biology 2023Quote: The miRCat-33 3’ linker was ligated to the 3’ end of the RNAs on the Ni-NTA beads with 800 units of T4 RNA ligase 2 truncated K227Q (New England Biolabs) in 1 x PNK buffer / 16.67% PEG 8000 in the presence of 80 units RNasin in a total volume of 80 µl ...
-
bioRxiv - Genomics 2023Quote: ... mRNA was eluted from the oligo-dT beads and fragmented by incubating with the First Strand Synthesis Reaction buffer and Random Primer Mix (2×) from the NEBNext Ultra II Directional Library Prep Kit for Illumina (#NEBE7760; New England Biolabs) for 15Lmin at 94°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... was digested with BbsI enzyme and pre-annealed 5’-end phosphorylated sgDNA sequences (found in Extended file 2) inserted using Quick Ligase (New England Biolabs), and subsequently transformed into Stabl3 TM E ...
-
bioRxiv - Developmental Biology 2023Quote: ... for small RNA library preparation 50 to 300 ng of total RNA was ligated with randomized 3’ adapter using T4 RNA ligase 2 truncated KQ (NEB) in 1X T4 RNA ligase reaction buffer (NEB ...
-
bioRxiv - Developmental Biology 2023Quote: ... 50 nM of RCA primer, 1U/µL of RiboProtect (Blirt, #RT35) and 0.5 U/ µL of T4 RNA Ligase 2 (NEB, # M0239L). The ligation mix was introduced to the SecureSeal chamber and incubated on the samples for 2 hours at 37 degrees Celsius ...
-
bioRxiv - Bioengineering 2023Quote: ... Cells were washed two times in barcode wash buffer (+5 μM each of quenching oligo 1 & 2) and then resuspended in ice cold 1x ThermoPol reaction buffer (NEB) cells were passed through a 40μm strainer and counted ...
-
bioRxiv - Cancer Biology 2023Quote: ... then split in 2 for PCR amplifications with either Minus or Plus primers using Q5 DNA Polymerase (New England Biolabs) with the following cycling conditions ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 µL i7 unique index primer (10 µM) and 25 µL NEBNext® High-Fidelity 2X PCR Master Mix (NEB) and subjected to the following PCR program ...
-
bioRxiv - Genetics 2024Quote: ... the targeted tars-1 region was amplified by PCR (primer sequences in Supplemental Table 2) using Q5 PCR mix (New England Biolabs). Amplicons were then purified with DNA Clean and Concentrator kits (Zymo Research ...
-
bioRxiv - Microbiology 2024Quote: ... Libraries were then size selected for cDNA target fragments of 200–300 bp on 2% Low Range Ultra Agarose followed by PCR amplified using Phusion DNA polymerase (NEB) for 15 PCR cycles ...
-
bioRxiv - Genomics 2024Quote: ... The purified scaffold insert (2 ng) was ligated with the digested intermediate plasmid library vector (200 ng) using T4 DNA Ligase (NEB) at room temperature for 45 min ...
-
bioRxiv - Microbiology 2024Quote: ... Libraries were then size-selected for cDNA target fragments of 200–300 bp on 2% Low Range Ultra Agarose followed by PCR amplification using Phusion DNA polymerase (NEB) for 15 PCR cycles ...
-
bioRxiv - Microbiology 2024Quote: ... 2 kb fragments upstream and downstream of SrcF were PCR amplified with Q5 High Fidelity DNA Polymerase (New England Biolabs) and cloned in PCR amplified pEx-deletion-ermG via DNA Gibson assembly (HiFi DNA Assembly Master Mix ...
-
bioRxiv - Biochemistry 2023Quote: ... or targeting a specific sequence within the puromycin resistant cassette (P3 Supplementary Table 2) were mixed with 1 unit HiFi Polymerase (Q5 HF DNA Polymerase, M04915, NEB) and 1× HiFi reaction buffer with MgCl2 ...
-
bioRxiv - Bioengineering 2024Quote: ... containing 0.06 % pluronic acid (F-127, final concentration) and 1 µL of each disulfide bond enhancer 1 and 2 (NEB #E6820). We used droplet oil consisting of 3M™ Novec™ HFE7500 Engineered Fluid (3M ...
-
bioRxiv - Systems Biology 2024Quote: ... We digested ∼2ug of each of 24 barcoded ORF plasmid pools (2 replicate pools of each of 9 hORFs and 3 vORFs) overnight with I-SceI (NEB) according to manufacturer’s recommendations ...
-
bioRxiv - Biophysics 2024Quote: ... cDNA (2 μl) was used as template in 50 μl PCR reaction with Phusion Hot start flex (New England Biolabs). Reaction conditions ...
-
bioRxiv - Plant Biology 2024Quote: ... with 2 µg of the freshly synthetized SgRNA1 obtained with the HiScribe™ T7 High Yield RNA Synthesis Kit (NEB). DNA repair templates containing the fenhexamid resistance cassette surrounded by 60 bp of the target gene for HR were obtained by PCR ...
-
bioRxiv - Plant Biology 2024Quote: ... Libraries were selected for cDNA target fragments of 300 bp on 2% Low Range Ultra Agarose followed by PCR amplified using Phusion DNA polymerase (NEB) for 15 PCR cycles ...
-
bioRxiv - Immunology 2023Quote: ... Completed libraries were then sequenced to an average depth of approximately 20M reads per sample on a partial lane of the NovaSeq6000 S4 XP flow cell using 2×150 paired-end reads with 10-base dual indexes (CAS: E6440S, NEB). After demultiplexing these samples ...
-
bioRxiv - Molecular Biology 2023Quote: ... Monophosphorylated RNAs were ligated to 3′ adapters ( rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/, IDT) using T4 RNA ligase 2 in 25% PEG 8000 (NEB) at 15°C overnight ...
-
bioRxiv - Pathology 2023Quote: Total RNA extracted from hearts of Ctrl and Eprs1cKO-homoat 2 weeks post tamoxifen injection were treated with DNase I (NEB) to remove potential genomic DNA in the RNA samples ...
-
bioRxiv - Microbiology 2024Quote: ... The linearized vector and PCR-amplified sequences were mixed at a 1:2 molar ratio and assembled using the NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs) following the manufacturer’s instructions ...