Labshake search
Citations for New England Biolabs :
1501 - 1550 of 1593 citations for TIM 3 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... and Lachnospiraceae bacterium Cpf1 (LbCpf1) (200 nM) were independently preincubated with sgRNA (600 nM) in cleavage buffer [1× NEBuffer 3 (New England Biolabs, Ipswich, MA), 10 mM DTT ...
-
bioRxiv - Genomics 2022Quote: ... to 5 μg of input DNA (in total volume of 24 μl at >210 ng/μl) with 3 μl 10X CutSmart Buffer (NEB, Cat #B7204), and incubating for 10 min at 37°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... and then enriched via PCR amplification in a total volume of 50 μL containing 3 μL of NEB Next USER Enzyme (NEB, Ipswich, USA), 25 μL of NEB Next High-Fidelity PCR Master Mix (2× ...
-
bioRxiv - Biochemistry 2019Quote: ... A 3’ DNA adapter (CTATAGTGTCACCTAAATTAATACGACTCACTATAGGG) that contains 5’ phosphate and 3’ spacers was first 5’-adenylated using a 5’-adenylation kit (NEB #E2610-S) at 65°C for 1 h ...
-
bioRxiv - Genomics 2019Quote: ... 3 µg of dam-dcm- plasmid DNA in a 50 µl reaction containing 20 U of M.SssI methylase (NEB, Ipswich MA, USA), 1X NEBuffer 2 ...
-
bioRxiv - Genetics 2021Quote: ... DNA fragments with A-3’ end overhangs were then ligated to the DS adaptors with T-3’ overhangs using the NEBNext® Ultra™ II Ligation Module (New England Biolabs) following the manufacturer’s instructions and then purified by 0.8 volumes of AMPure XP beads (Beckman Coulter).
-
bioRxiv - Biochemistry 2020Quote: ... The doubly-digested vectors were assembled with a single fragment containing the ORF containing 5’ and 3’ adapters for Gibson assembly using 2x NEB Hifi Mastermix (NEB, Ipswich, MA). The finished constructs were transformed into BL21 Rosetta (DE3 ...
-
bioRxiv - Microbiology 2020Quote: ... reverse primer S-D-Bact-0785-b-A-18 (5’ TAC NVG GGT ATC TAA TCC 3’) and a high fidelity Taq polymerase master mix (Q5, New England Biolabs, Massachusetts, USA). Primer sequences were based on Klindworth et al.24 ...
-
bioRxiv - Microbiology 2020Quote: ... 1-3 μg RNA was used to generate sequencing libraries with NEBNext Ultra™ RNA Library Prep Kit for Illumina (#E7530L, NEB, USA) with poly(A ...
-
bioRxiv - Plant Biology 2021Quote: The purified PCR reaction was then A-tailed with 15 units Klenow Fragment (3’ – 5’ exo-) (New England BioLabs; Ipswitch, MA, USA) in 1X NEB Buffer 2 (New England BioLabs ...
-
bioRxiv - Molecular Biology 2020Quote: ... The solution was transferred to 42°C for 15 min and incubated overnight in 3 U of β-agarase I (New England Biolabs, M0392). Next ...
-
bioRxiv - Neuroscience 2021Quote: ... Enzyme restriction with DpnII was performed in 30 µl reaction mix (1 µl DpnII, 3 µl DpnII buffer, 10 µl purified DNA and 16 µl H2O; New England Biolabs, Ipswich, MA) and incubation at 37°C for 2h ...
-
bioRxiv - Cell Biology 2020Quote: ... of full-length SEC16A were generated by mutating 10 nucleotides in the silencer-select Sec16A siRNA (5’-CGGAGCUUCUGUUACGAGATT-3’, siRNA id: s19236, Thermo-Fischer Scientific) binding site using Q5® Site-Directed Mutagenesis Kit (NEB, E0554S) following manufacturer’s instructions.
-
bioRxiv - Neuroscience 2020Quote: ... and reverse primer (5’-AAG ATT CTC GAG ATG GTG ATG GTG ATG G-3’) were combined using the Q5 site-directed mutagenesis protocol (New England Biolabs, Ipswitch, MA). The resulting plasmid ...
-
bioRxiv - Biochemistry 2020Quote: ... α1- 3,4,6), 10 U β-galactosidase (P0726S, β1-3) and 8 U β-galactosidase (P0746S, β1-3,4) (all from New England BioLabs, USA). All reactions were performed in a final volume of 10 μl in 50 mM sodium acetate buffer ...
-
bioRxiv - Bioengineering 2020Quote: ... protease mutant S219V [24] was inserted at the 3’ end of gene encoding maltose binding protein (MBP) in pMAL-c5E vector (New England Biolabs, MA, USA) to construct pMAL-TEV vector ...
-
bioRxiv - Genomics 2019Quote: ... and then cloned into a customized minigene plasmid (a derivative of the pSpliceExpress vector)29 containing an RSV-promoter and two control exons (rat insulin exons 2 and 3) using the NEBuilder® HiFi DNA assembly (NEB, E2621). Amplified fragments were inserted between the two control exons ...
-
bioRxiv - Biochemistry 2020Quote: ... or a control motif (5’-GGGACCCTGGGAGGG-3’) were prepared by viral replication using a helper phage M13K07 (New England BioLabs, Cat#N0315S). E.coli XL1-Blue cells were transformed with pBluescript SK(- ...
-
bioRxiv - Microbiology 2020Quote: ... The BAC containing viral cDNA was cleaved at a unique restriction site located downstream of the 3’-end poly(A) tail using NotI-HF (Ref. R3189S, NEB, Grenoble, France). In parallel ...
-
bioRxiv - Microbiology 2021Quote: ... HA tag sequences were added to the 3’ end of the hACE2 transgenic cDNA using a Q5® Site-Directed Mutagenesis Kit (NEB#E0554S) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: ... The gRNA target sequences GAAGAGGTGAACTGCCTTT (NIPBL exon 3) and CTCGTTCTGATTTTAACCG (NIPBL exon 10) were cloned into the gRNA empty vector using Phusion polymerase (M0530S: New England Biolabs, Ipswich, MA) and the Gibson assembly system (E5510S ...
-
bioRxiv - Cell Biology 2020Quote: The myo-3p::EFF-1 plasmid was constructed by cloning the myo-3 promoter region from myo-3p::mCherry plasmid with Sal I (New England BioLabs Cat#R3138) and Nhe I (ThermoFisher Cat# FD0974 ...
-
bioRxiv - Genomics 2021Quote: The beads were magnetically separated and 4 µl of hot PNK mix (0.2 µl PNK [New England Biolabs], 0.4 µl 32P-γ-ATP, 0.4 µl 10x PNK buffer [New England Biolabs], 3 µl H2O) was added and incubated for 5 min at 37°C in a thermomixer at 1,100 rpm ...
-
bioRxiv - Genomics 2021Quote: ... nascent RNA samples were processed through the following steps: (i) 3′ adapter ligation with T4 RNA Ligase 1 (NEB, Ipswich, MA; M0204), (ii ...
-
bioRxiv - Microbiology 2020Quote: ... the algR gene was amplified from gDNA using primers (algR-pUC-5, algR-pUC-3) and subcloned into pUC19 (New England Biolabs, Ipswich, MA). Site-directed mutagenesis was performed by amplification of pUC19::algR with primers (algR-D54E-Fw ...
-
bioRxiv - Developmental Biology 2020Quote: ... Samples were then 3’dephosphorylated by denaturing at 65°C for 5 min and incubating with T4 PNK (NEB, catalog no. M0201S) in a 10 μL reaction (7 μL precipitated RNA ...
-
bioRxiv - Cell Biology 2020Quote: ... primers 1 - 3) and then inserting the resulting PCR product into BamHI-digested pBMN-mCherry using Gibson assembly (New England Biolabs, Ipswich, MA). The resulting pBMN-ARHGAP36-mCherry vectors with XhoI and SacII restriction sites were subsequently used in all experiments described herein.
-
bioRxiv - Genetics 2021Quote: Sequencing libraries were prepared from either 500 ng total RNA or 3 µl TraPR-enriched [80] sRNA with the NEBNext Multiplex Small RNA Library Prep Set for Illumina (E7300; NEB, Ipswich, Massachusetts) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... Libraries were prepared for sequencing by Cambridge Genomics Services using 3 μg of total RNA and an Ultra™ RNA library prep kit for Illumina (NEB, USA). Libraries were quantified by PCR ...
-
bioRxiv - Genomics 2020Quote: ... and once the solution is clear 48 uL of the elution was transferred to a 2mL Lo-Bind tube with End-Repair and A-tail buffer (7 uL) and enzymes (3 uL) premixed (NEBNext® Ultra™ II kit, New England Biolabs). The solution was then mixed by gentle tapping and transferred to a 0.2 mL PCR tube and incubated at 20 degrees C for 30 minutes and 65 degrees C for 30 minutes in a thermocycler ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 0.1% Tween) with 3% BSA and then incubating the strips in 1:2000 dilution of monoclonal anti-MPB-HRP antibody (NEB, Inc, USA) in a blocking buffer for 1 h at room temperature ...
-
bioRxiv - Genetics 2019Quote: ... EcoRV-digested amplicons encoding gRNA pairs were inserted into the vector in 3 separate Gibson assembly reactions (NEB Gibson Assembly Master Mix) according to manufacturer’s specifications ...
-
bioRxiv - Genomics 2021Quote: ... 3 ng of DNA was used for library preparation according to NEBNext® Ultra™ II DNA Library Prep Kit (NEB, E7645S). Purity and size distribution was analyzed on Fragment Analyzer ...
-
bioRxiv - Biophysics 2021Quote: ... was annealed with primer P3 (100 bp long) at a 1:3 DNA to primer molar ratio and ligated using T4 DNA ligase (NEB, catalog #M0202S). Primer P3 had biotin modification at its 3’ end ...
-
bioRxiv - Molecular Biology 2022Quote: ... deglycosylation treatment (Dglyco) consisted of sample incubation for 3 hours at 37°C with 20 nL of Protein Deglycosylation Mix II (NEB, cat. P6044S) per μL of sample ...
-
bioRxiv - Genomics 2022Quote: ... RNA samples were then processed through the following steps: (i) 3′ adapter ligation with T4 RNA Ligase 1 (NEB, Ipswich, MA; M0204), (ii ...
-
bioRxiv - Genetics 2022Quote: ... the homology 5’arm and 3’arm was amplified and linked to the pBS backbone with Gibson Assembly Kit (NEB, cat. no.E2611L) as ‘pBS-CG32814-arm’ ...
-
bioRxiv - Plant Biology 2022Quote: ... The doubly digested vectors were assembled with a single fragment containing the ORF containing 5′ and 3′ adapters for Gibson assembly using 2x NEB Hifi Mastermix (NEB, Ipswich, MA). The finished constructs were transformed into BL21 Rosetta (DE3 ...
-
bioRxiv - Microbiology 2022Quote: ... RNAs (either from ribosome footprints or fragmented RNAs from total cytoplasmic RNAs) were dephosphorylated at their 3’ end using PNK (New England Biolabs, Cat: M0201) in the following buffer ...
-
bioRxiv - Microbiology 2022Quote: ... A repair template plasmid carrying the ~1 kb of sequence immediately 5’ and 3’ to this gRNA sequence from the H99 genome was constructed using HiFi DNA Master Mix (NEB Cat#E2621) with a standard NATR cassette inserted between the two flanks ...
-
bioRxiv - Systems Biology 2022Quote: ... The libraries were then run on a 3% agarose gel and the product was extracted using NEB Monarch DNA Gel Extraction Kit (NEB, Cat# T1020L). Next ...
-
bioRxiv - Cell Biology 2024Quote: ... containing a 5′-Biotin-PC group and a 3’-OH (Sup. Table. 2) were ligated to the 5′ end of RNAs using T4 RNA ligase (NEB, Cat #M0204S) for 3 hours at 37°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... About 3 µg of DNA from each sample was digested with two restriction enzymes (PstI; NEB catalog #R0140 and XhoI; NEB catalog #R0146). The digested genomic DNA was resolved on a 1% ...
-
bioRxiv - Microbiology 2024Quote: ... A repair template plasmid carrying the ∼1 kb of sequence immediately 5’ and 3’ to this gRNA sequence from the H99 genome was constructed using HiFi DNA Master Mix (NEB Cat#E2621) with a standard HYGR cassette inserted between the two flanks ...
-
bioRxiv - Genomics 2024Quote: ... Small RNA sequencing libraries were prepared using the NEBNext Multiplex Small RNA Library Prep Set for Illumina following the manufacturer’s recommendations with the 3’ ligation step changed to 16°C for 18 hours to improve capture of methylated small RNAs (New England Biolabs, cat# E7300S). Small RNA PCR amplicons were size selected on 10% polyacrylamide non-denaturing gels ...
-
bioRxiv - Immunology 2024Quote: ... cDNA for 3’ RACE was generated using RNA from IFN-β treated A549 cells using the Template Switch RT Enzyme Mix (NEB, #M0466) and anchored primers ...
-
bioRxiv - Developmental Biology 2023Quote: ... the 3′ ends of small RNA were ligated to an adapter using T4 truncated RNA ligase (Lucigen, Cat# LR2D11310K and NEB, Cat# M0242L), followed by the ligation of the 5′-end adaptors by T4 ligase ...
-
bioRxiv - Immunology 2023Quote: ... using primers that overlapped with pLenti-EF1-Blast at the xho1 site on the 5’ end and overlapped with the 5’-end of the RNase L coding sequence on the 3’-end (Supplementary table 1) and NEBNext® High-Fidelity 2X PCR Master Mix (New England Biolabs: M0541S). RNase L coding sequence was amplified using a 3’-end primer that overlapped with pLenti-EF1-Blast at the xba1 site ...
-
bioRxiv - Microbiology 2023Quote: ... DNA end was repaired and addition of adenosine at the 3’ end of the DNA was performed with NEBNext Ultra II End Repair/dA-Tailing Module (New England Biolabs, Cat# E7546). A linker was ligated to the ends of DNA using the NEBNext Ultra II Ligation Module (New England Biolabs ...
-
bioRxiv - Plant Biology 2024Quote: ... cDNA was A-tailed with Fermentas Klenow 3′ to 5′ exonuclease (Cat# EP0421) and ligated with adaptor oligonucleotides (NEB NEXT adaptor oligos) using Mighty Mix Ligase (Cat# TAK6023) ...