Labshake search
Citations for New England Biolabs :
1501 - 1550 of 1780 citations for 7 chlorobenzo b thiophen 3 2H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... Beads were washed and resuspended in NEBuffer 3 containing Calf Intestinal Alkaline Phosphatase at a concentration of 0.5 U/μl (NEB, M0290) to dephosphorylate the RNA ...
-
bioRxiv - Genetics 2022Quote: ... I23A was introduced at the same time with GFP knock-in by incorporating the corresponding mutation in the 3’ homology arm on the repair template plasmid using the Q5 site-directed mutagenesis kit (New England Biolabs). GermLine Optimized mScarlet-i sequence (Fielmich et al ...
-
bioRxiv - Genetics 2022Quote: ... 5 ’TTAGCTCTTAAAC NNN…NN NCCAACAAG 3’) and ligating them together with the linearized vector using the T4 DNA ligase enzyme (NEB). Cloning of sgRNAs in a multiguide expression system (SP199 ...
-
bioRxiv - Genomics 2022Quote: ... The DNA was digested with MluCI (5µl Cut smart buffer, 1.5-2 µg DNA, 3 µl MluCI (New England Biolabs Inc. (NEB), and water to make up 49 µl ...
-
bioRxiv - Molecular Biology 2022Quote: ... The RNA was then end-repaired with 20 U of 3’-phosphatase-positive bacteriophage T4 polynucleotide kinase (T4 PNK; New England Biolabs), using conditions recommended by the supplier (1× PNK buffer without ATP ...
-
bioRxiv - Microbiology 2022Quote: ... then 3’-adenylated and NEXTflex HT Barcodes (Bio Scientific Corporation) were added using NEBNext DNA modules products (New England Biolabs). After two consecutive cleanups with 1×AMPure XP ...
-
bioRxiv - Pathology 2022Quote: ... A targeting vector with P2A-CreERT2-T2A-GFP-stop codon-rabbit beta globin polyA sequence flanked by 5’ and 3’ homology arms was generated using NEBuilder HiFi DNA Assembly (NEB) and cloned into a pKO2 backbone plasmid ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Beads were then dried before adding 50 µL DNaseI mix (3 U of DNaseI in 1X DNAse buffer (NEB, #M0303L) and incubated at 37 °C for 10 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... and a synthetic 391 bp double-stranded DNA fragment encoding 5′-(1st gRNA/scaffold/H1 promoter/2nd gRNA)-3′ was inserted using the NEBuilder HiFi assembly system (NEB). Synthetic DNA fragments were ordered from Genewiz and sequences are listed in Supplementary Table 3 ...
-
bioRxiv - Systems Biology 2023Quote: Mutated or wild type sequences of RORC 3’UTR were cloned into the dual GFP-mCherry reporter using MluI-HF and PacI restriction enzymes (NEB) as described above ...
-
bioRxiv - Genomics 2022Quote: ... pJR98 was digested by AscI and ssDNA oligo donors of the sequence 5’ CTCTTCCTGCCCGACCTTGGGG – reverse complement IBC – CAGCGCCATAGCTGAGTGTAGATTCGAGC – 3’ were cloned into the vector using NEBuilder HiFI DNA Assembly Master Mix (NEB). Third ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 nM RNAse-free DNA fragments containing gRNA target sequences and 30 nM Cas9 or Cas12a protein (NEB, Ipswich, MA) were mixed in reaction tubes as per manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... IVT RNA products (2×10-3 dilution) were tested for absence of carry-over plasmid template by PCR using Taq 2X master mix (NEB). A negative PCR result would confirm the absence of carryover plasmid in the IVT product.
-
bioRxiv - Microbiology 2022Quote: ... The cDNA was treated with RNase H before second-strand synthesis by Klenow fragment (3′ to 5′ exonuclease) (New England Biolabs), then the double-stranded cDNA was sheared into average of 200 bps fragments using a Covaris focused ultrasonicator E210 ...
-
bioRxiv - Microbiology 2022Quote: ... The 5’-RNA adapter (5’-CCUUGGCACCCGAGAAUUCCA-3’) was ligated to the 5’ end of the RNA using T4 RNA ligase I (NEB). RNA was purified as above by binding to streptavidin beads ...
-
bioRxiv - Molecular Biology 2022Quote: ... were annealed to an oligonucleotide containing the antisense of the 3’ restriction site (5’-GGT TGA TTA TCG ATA AGC TT-3’) and extended using Klenow Polymerase devoid of exonuclease activity (NEB). Resulted fragments were inserted into the pAAV-CAG-hFXN plasmid between the stop codon of the hFXN and poly A signal ...
-
bioRxiv - Synthetic Biology 2022Quote: ... or PCR amplified using primers that anneal to the 5’ or 3’ ends of each chunk with Phusion polymerase (New England Biolabs). Plasmid digested or PCR amplified chunks were excised from agarose gels or column purified ...
-
bioRxiv - Physiology 2022Quote: RNA-sequencing libraries were prepared by depleting eukaryotic ribosomal RNA with the NEBNext rRNA Depletion Kit prior to library synthesis with the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina and addition of multiplex oligos using the Unique Dual Index Primer Pairs Set 3 (NEB). Library quality control was performed using Qubit and Bioanalyzer 2100 ...
-
bioRxiv - Microbiology 2022Quote: ... the pulL gene was PCR-amplified from plasmid pCHAP8258 as template using primers PulL Kpn 5 and PulL Eco 3 with the high-fidelity Q5 DNA polymerase (New England Biolabs). The PCR products were purified on a Qiaquick spin column ...
-
bioRxiv - Cell Biology 2022Quote: ... The 3′ end of the fragmented RNA was dephosphorylated with T4 polynucleotide kinase (PNK, New England Biolabs, Ipswich, MA, USA) followed by heat-inactivation ...
-
bioRxiv - Microbiology 2023Quote: ... The library preparation including an enrichment step for 5’-triphosphorylated RNAs by capping the RNAs with 3’-desthiobiotin-TEG-GTP (NEB) [15] and subsequent deep sequencing on a Illumina NextSeq 500 system with 75 bp read length were conducted at Vertis Biotechnologie (Germany ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 3 µL of the assembly product was used to transform 65 µL of T7 Express chemically competent cells (NEB #C2566I) according to the manufacturer’s high-efficiency transformation protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... Deletions within the nhr-23 3′ UTR reporter (cloned in pHR017) were created using a Q5 Site-Directed Mutagenesis Kit (NEB) and verified by Sanger Sequencing (Genewiz Inc.) ...
-
bioRxiv - Microbiology 2023Quote: ... an ‘A’ base was added to the 3’ end of the blunt-end phosphorylated DNA fragments using the polymerase activity of Klenow (Exo-Minus) polymerase (NEB); Illumina genomic adapters were ligated to the A-tailed DNA fragments ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... while the pML104-PDR1 vector has a guide sequence 5’- CTGGATAAACGTCGCTCCAC-3’ introduced by Q5 polymerase PCR (New England Biolabs) and In-Fusion Snap Assembly (Takara ...
-
bioRxiv - Cell Biology 2023Quote: ... Donor sequences were then inserted at the HindIII (5’) and XhoI or BamHI at (3’) sites using HindIII-HF and XhoI-HF or BamHI-HF (New England Biolabs).
-
bioRxiv - Neuroscience 2023Quote: ... 3 µL of RNA from 4 x 96 well plates was transferred to a 384 well plate with 3 µL of master mix containing 1 µL of a 10 mM stock of dNTPs (NEB Catalog# N0447L ...
-
bioRxiv - Microbiology 2023Quote: ... was synthetized by introducing a 984 bp fragment from the 3′ end of the GEXP15 ORF into pGDB between the XhoI/AvrII (New England Biolabs). PetDuet-1 was purchased from Novagen.
-
bioRxiv - Microbiology 2023Quote: ... The 5’ end ligated samples were purified using PCI extraction and then the 3’ App-PE adapters were ligated to the RPF using 40 U T4 RNA ligase I (NEB). The 5’ and 3’ ligated samples were resolved on a 12% TBE-Urea polyacrylamide gel and the band corresponding to the RPF was gel-excised ...
-
bioRxiv - Cell Biology 2023Quote: ... and inserted between Gly118- and Glu119-encoding codons of odr-3 (72) in the modified pMC10 vector using NEBuilder HiFi DNA assembly (NEB). The resulting plasmid sequence was confirmed by Sanger sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... PCRs were performed using specific reaction primer pairs specific to the appropriate parental segment (Table 3) and Q5 High-Fidelity Polymerase (NEB) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... and primers listed in (Extended Data Table 3) and used for in vitro transcription by T7 RNA polymerase (New England Biolabs). Resulting RNA was purified using a spin-column kit (RNeasy mini kit ...
-
bioRxiv - Molecular Biology 2023Quote: ... or MnlI was at 37 °C for 2 h (EcoRI-HF) or 3 h (HhaI or MnlI) in rCutSmartTM Buffer (NEB). Nuclease S1 (Boehringer Mannheim ...
-
bioRxiv - Microbiology 2023Quote: ... The 32P-radioabelled RNase III.RNA complexes were washed and unique barcoded 5’ linkers and 3’ App-PE adapters were ligated to the bounded RNA using 40 U T4 RNA ligase I (NEB) for each ligation step ...
-
bioRxiv - Cancer Biology 2023Quote: ... and ligated to hairpin adaptor 2 (ENDseq-adaptor-2, 5′-Phos-GATCGGAAGAGCACACGTCUUUUUUUUAGACGTGTGCTCTTCCGATC*T-3′ [*phosphorothioate bond]) (Quick ligation kit, NEB). To prepare libraries for sequencing ...
-
bioRxiv - Developmental Biology 2023Quote: ... and cloned under control of the hlh-3 promoter in pSL780 (Bone et al., 2016) with Gibson cloning (New England Biolabs) to generate pSL814 ...
-
bioRxiv - Biophysics 2023Quote: ... We combined the plasmid backbone with the colony PCR insert by mixing them in molar ration 1:3 in the 2xHiFi mix (New England Biolabs). We incubated the reaction at 50°C for 60 min ...
-
bioRxiv - Biophysics 2023Quote: ... was used.23 The RNA was ligated to a 5ʹ-phosphorylated-Cy3-oligo at the 3’ end of the RNA by T4 RNA ligase (NEB) by following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... Second-strand DNA synthesis was done by ligating 10 µM of a blunt-end duplex comprised of a 32-bp Illumina R1-3’SpC3 and 5’-phosphorylated R1R-3’SpC3 DNA (pre-annealed by incubating at 95°C for 3 min and slowly cooling to 25°C) using a Quick ligase kit (New England Biolabs) according to manufacturer’s protocol followed by clean-up as described above ...
-
bioRxiv - Molecular Biology 2023Quote: ... The purified ribodepleted RNA samples were fragmented for 3 minutes at 94°C in Magnesium RNA Fragmentation Module (New England Biolabs) and 3’ ends were dephosphorylated with T4 polynucleotide kinase (Lucigen) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The variant library was ligated into each vector with a 1:3 (insert: vector) T4 ligation at 16°C overnight (NEB). Ligations were DNA cleaned (Zymo) ...
-
bioRxiv - Immunology 2023Quote: ... were incorporated onto the mab-oligos via a 50 μl gap-fill ligation reaction consisting of 40 U Taq ligase (New England Biolabds) 3 U T4 DNA polymerase (New England Biolabs), 100 μM dNTPs ...
-
bioRxiv - Microbiology 2023Quote: ... standard curve transcripts and viral RNA in the samples were reverse transcribed with a reverse E1 primer containing a nongenomic tag sequence74 5’-CAGACAGCACTCGTTCGTACAC-3’ through the Protoscript II First Strand cDNA Synthesis Kit (New England Biolabs). The (+ ...
-
bioRxiv - Microbiology 2023Quote: ... we transcribed T7 promoter-pre-Let7c 5’GCTCCUUGGUUUGCTUGUUGGTTGTUCUGTTUUCTCCCUGGGTGTUUCTCTUUU CCUTUCUUCCTUCTUCCTCUUCCCGGUTGCCCTATAGTGTGAGTCGTATTA 3’ and T7-promoter-pre-miR29a 5’ATAACCGATTTCAGATGGTGCTAGAAAATTATATTGACTCTGAACACCAAAAGAAA TCAGTCCCTATAGTGAGTCGTATTA3’ using the T7 high yield RNA synthesis kit (BioLabs) with α 32P UTP (Perkin Elmer ...
-
bioRxiv - Developmental Biology 2023Quote: ... 3 µl of the purified assembly is incubated with 50 µl of NEB 10-β-competent E.coli cells (NEB, C3019H) for 30 min at 4 ℃ ...
-
bioRxiv - Cell Biology 2023Quote: ... 5’-TGGCCAGACGGAATCCAATG-3’ and 5’-GTGGTGGGCCACCAAGACGG-3’, and cloned into pX330-P2A-EGFP/RFP (Zhang et al, 2017) through ligation using T4 ligase (New England Biolabs). Nup96-GFP KI U2OS cells were transfected using X-tremeGENETM 9 DNA Transfection Reagent (Roche) ...
-
bioRxiv - Cell Biology 2023Quote: ... all strains were generated by the S1/2/3/4 homologous recombination PCR integration method (Janke et al., 2004) using a Q5 PCR Kit (NEB). S1-S2 primers was used to knock out endogenous proteins ...
-
bioRxiv - Cell Biology 2023Quote: ... then the reactions were made to a total volume of 80 µL containing 1 equivalent of GlycoBuffer2 and 3–5 µL of Remove-iT PNGase F (P0706, NEB), incubated at 37°C for 2 hours ...
-
bioRxiv - Cell Biology 2023Quote: ... Two gRNAs targeting UBAP2L (5’-TGGCCAGACGGAATCCAATG-3’ and 5’-GTGGTGGGCCACCAAGACGG-3’) were cloned into pX330-P2A-EGFP/RFP (Zhang et al, 2017) through ligation using T4 ligase (New England Biolabs) using the following primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... Non-IRES mRNAs were capped the 3’-O-Me-m7G(5’)ppp(5’)G anti-reverse cap analog (NEB # S1411L). IRES mRNAs were capped with the A(5’)ppp(5’)G cap analog (NEB # S1406L) ...