Labshake search
Citations for New England Biolabs :
1501 - 1550 of 1902 citations for 5 nitrobenzothiazole since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2020Quote: Digested DNA was heated to 50° C for 5 minutes to melt paired sticky ends then put into a 200 μL Klenow fragment (exo-, NEB) fill-in reaction containing 36 μM biotin-14-dCTP (Thermo Fisher ...
-
Suppressing STAT3 activity protects the endothelial barrier from VEGF-mediated vascular permeabilitybioRxiv - Molecular Biology 2020Quote: ... to a final concentration of 0.1µg/ml was incubated with 3 µg purified STAT3 proteins as well as 5 µl ATP (New England Biolabs; N0440S) for 30 minutes at 30°C ...
-
bioRxiv - Systems Biology 2019Quote: ... the sRNA gene of interest was cloned at the transcriptional +1 site under Para control by amplifying the pBAD+1 plasmid (Supplementary Table 5) by inverse PCR using Q5 DNA Polymerase (NEB). The pBAD+1 template is derived from pBADmycHisA (Tree et al. ...
-
bioRxiv - Genomics 2020Quote: ... Fragment ends were repaired using the NEBNext End Repair Module and adenosine was added at the 3’ ends using Klenow fragment (3’ to 5’ exo minus, New England Biolabs). Precipitated DNA was incubated with adaptors at room temperature for 1 hr with T4 DNA ligase (New England Biolabs ...
-
bioRxiv - Genomics 2020Quote: ... Fragment ends were repaired using the NEBNext End Repair Module and adenosine was added at the 3’ ends using Klenow fragment (3’ to 5’ exo minus, New England Biolabs). Precipitated DNA was incubated with adaptors at room temperature for 1 h with T4 DNA ligase (New England Biolabs ...
-
bioRxiv - Plant Biology 2020Quote: ... epicentre cat # ER0720 or ER81050-we used this one) and A-tailing (100mM dATP; bioPioneer inc, Klenow; (3’-5’ exo- NEB) # M0212L (1,000 units ...
-
bioRxiv - Molecular Biology 2020Quote: ... put on ice for 5 min and the following components were added in the specified order: 1x capping buffer (NEB), 0.5 mM GTP ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 5’ ends of ds-probes were radioactively labelled with [ψ-32P]-ATP using T4 polynucleotide kinase (New England Biolabs), purified on Illustra Microspin G-25 columns (GE) ...
-
bioRxiv - Microbiology 2019Quote: ... and YO-3009 (5’-ggg ccc acc ggt CGC CAG AAT GCG TTC GCA CAG CCG CCA GC-3’) and Q5 polymerase (NEB), then cloned into the SacI and AgeI sites of pSL1180/S17DN ...
-
bioRxiv - Biochemistry 2021Quote: ... primers used are listed in Supplementary Table 5 and PCR was performed by standard procedures using Phusion high fidelity DNA polymerase (NEB). Gene deletion of sll1951 was performed by amplifying an upstream 966bp fragment in the N-terminal region of sll1951 using primers Sll1951leftfor and Sll1951leftrev and a 954bp downstream fragment in the N-terminal region of sll1951 using primers Sll1951rightfor and Sll1951rightrev ...
-
bioRxiv - Biochemistry 2021Quote: ... The insert is fused during cloning through an overlapping proline-encoding CCG codon introduced by reverse and forward primers at the 3’- and 5’-end of the sybodies and MBP respectively and released by digestion with the Type IIS restriction enzyme SapI (NEB). The second proline of the linker is encoded in the forward primer of the MBP (3’ of the overlapping CCG codon ...
-
bioRxiv - Genetics 2019Quote: ... around 300 nanogram of total RNA from each sample was first treated with RNA 5’ Pyrophosphohydrolase (New England Biolabs, MA) at 37°C for 30 minutes ...
-
bioRxiv - Systems Biology 2019Quote: ... and C-terminal AD was instead PCR amplified from pGADCg using forward primer AP36 and reverse primer AP38 (5’ GCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGGCAGcatctattgaagtaat aataggcgcatg 3’) and cloned into NotI- and XmaI-digested (NEB) pDest-AD-QZ213 via homologous recombination in yeast ...
-
bioRxiv - Genomics 2021Quote: The supernatant was magnetically removed and the beads were resuspended in 20 µl of L3 DNA linker ligation mixture (8 µl water, 5 µl 4X ligation buffer, 1 µl RNA ligase [New England Biolabs] ...
-
bioRxiv - Genomics 2021Quote: ... a 5’ adenylated DNA oligonucleotide containing the complement of an Illumina Read 1 sequencing primer-binding site was then ligated to the 3’ cDNA end with Thermostable 5’ AppDNA / RNA Ligase (New England Biolabs). Properly ligated cDNAs were amplified by PCR (12 cycles ...
-
bioRxiv - Genomics 2021Quote: ... “Fuorf_RNA_adapter” was ligated to the 3’ end of 10 μl of cDNA in a 20 μl reaction at 65 °C for 1 hour using Thermostable 5’ App DNA/RNA ligase (New England Biolabs). The reaction was inactivated at 95 °C for 3 minutes and 2 μl of the reaction was used as a template for PCR for sequencing library generation as described below.
-
bioRxiv - Genetics 2021Quote: ... 5’TTGGNNN…NNNGTTTAAGAGC3’and Oligo R: 5’TTAGCTCTTAAACNNN…NNNCCAACAAG3’) and ligating them together with the linearized vector using the T4 DNA ligase enzyme (NEB).
-
bioRxiv - Genetics 2021Quote: ... and Gibson-assembled in a final volume of 5 µl using NEBuilder HiFi DNA assembly master mix (NEB, Ipswich, MA), according to manufacturer’s instructions ...
-
bioRxiv - Physiology 2021Quote: ... A K13 propeller domain-specific guide gRNA was introduced into this vector at the BbsI restriction sites using the oligo pair p1+p2 (Supplementary file 5) using T4 DNA ligase (New England BioLabs). Oligos were phosphorylated and annealed prior to cloning ...
-
bioRxiv - Genomics 2021Quote: ... End fill-in and A-tailing were performed by addition of Klenow Fragment 3’ --> 5’ exo-(Enzymatics) and dNTP mix (10 mM dATP, 1 mM dCTP, 1 mM dGTP New England Biolabs). After ligation to methylated Illumina TruSeq LT v2 adaptors using T4 DNA Ligase rapid (Enzymatics) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Flanking primers contain 20 bp of 5’ and 3’ overlap with the pcDNA3.1 vector for Gibson Assembly (New England Biolabs, #E5510). The resulting library had an estimated complexity of 322 = 1024 codon variants and 202 = 400 amino acid variants ...
-
bioRxiv - Genomics 2020Quote: ... The pbp2x 5’-end and 3’-end amplicons were spliced with the linearized pBBL740 amplicon using NEBuilder HiFi kit (New England Biolabs). The resultant spliced plasmid was transformed into parental strain MGAS27213-L601P and single cross-over transformants were selected by plating on THY agar with chloramphenicol 10ug/ml ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The PCR reaction was simplified to include 5 μl NEB Q5 Hot Start High Fidelity Master Mix (New England Biolabs), 1μl of the LCO_mod primer ...
-
bioRxiv - Physiology 2021Quote: ... ChIP-seq libraries were prepared from 1 to 5 ng eluted DNA using NEBNext Ultra II DNA library Prep Kit (New England BioLabs), with 12 cycles of library amplification ...
-
bioRxiv - Biochemistry 2021Quote: ... The tested interference substrates of either target strand (TS) or non-target strand (NTS) were 5′-radiolabeled with T4 PNK (NEB) in the presence of gamma 32P-ATP ...
-
bioRxiv - Biochemistry 2021Quote: ... The reaction was then supplemented with 5 mM DTT and the same concentrations of T4 polynucleotide kinase (New England BioLabs) and [γ-32P]-ATP (PerkinElmer ...
-
bioRxiv - Biochemistry 2021Quote: ... RNA (50 pmol) was radiolabelled at 5′ end with by using 10 units of T4 polynucleotide kinase (New England Biolabs) mixed to 3 μl of γ32P-ATP (3000 Ci/mmol 10 mCi/ml ...
-
bioRxiv - Developmental Biology 2021Quote: ... Biotin removal from unligated fragments was performed by incubating DNA samples for 4h at 20C in a mix of 5 mL of 10X NEB2 buffer (New England Biolabs), 5 mL of a 1mM dNTPs mix ...
-
bioRxiv - Biochemistry 2021Quote: ... and plasmid IRES sequence (IRES_rev) using 5% of the genomic DNA as a template and Q5 polymerase (New England Biolabs - NEB) at 100 μL scale ...
-
bioRxiv - Genetics 2021Quote: ... An AMA1 replication vector backbone (pFCBB) of 10,129 bases was obtained from pFC332 (5) by restriction digest using PacI and BamHI-HF® (NEB), excising part of the Nt.BbvCI –PacI cloning site ...
-
bioRxiv - Microbiology 2021Quote: ... reverse: 5’-GATGGCGTGGAACCATGTC-3’) were obtained from the wild type plasmids pCMV-hnCoV-S via Q5 SiteDirected Mutagenesis Kit (NEB). pCMV-hnCoV-S-H501Y-Δ69/70 was obtained from pCMV-7.1-hnCoV-S-H501Y (forward ...
-
bioRxiv - Immunology 2020Quote: ... cDNA synthesised with SMARTNNN oligos were treated with 1 μl of Uracil DNA glycosylase (5 U/μl, New England Biolabs) and incubated for 15 minutes at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... Gel extracted DNA fragments were incubated in a ratio of 1:3 of plasmid to insert (1:5 for inserts smaller than 300 nucleotides) in the presence of Gibson Assembly master mix (NEB) at 50°C for 1 hour.
-
bioRxiv - Evolutionary Biology 2021Quote: ... The fragment was amplified by PCR using primers piLepF1 (5“-TCTACAAATCATAAAGATATTGGAAC-3”) and LepR1 (5“-TAAACTTCTGGATGTCCAAAAAAATCA-3”) (Hebert et al., 2004) using OneTaq Mastermix with standard buffer (New England Biolabs) under standard cycling conditions ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.5–1 μg of circFL-seq cDNA was repaired and dA-tailed by the NEBNext FFPE DNA Repair Mix (NEB) and NEBNext Ultra II End repair/dA-tailing Module (NEB) ...
-
bioRxiv - Immunology 2020Quote: ... 70°C for 10s and 72°C for 30s) and 1x 72°C for 5 min) using the Q5 polymerase (New England BioLabs) and cloned into pUC57 using the MEGAWHOP35 method ...
-
bioRxiv - Immunology 2021Quote: ... 3’ arm of homology to exon 5 was cloned into BamH1-NotI-digested PL451 (contains Neomycin cassette and loxP; NCI Frederick) using T4 DNA Ligase (NEB). Third ...
-
bioRxiv - Neuroscience 2020Quote: ... + 5 % non-fat milk for 1 hour at room temperature before incubating with primary antibody: anti-GFP (1:1000, Biolabs) or anti-actin (1:5000 ...
-
bioRxiv - Developmental Biology 2020Quote: ... 2 PCR2 reactions were used per timepoint with 5 μL of PCR1 product amplified with 25 μL Q5 High Fidelity 2X Master Mix (NEB), 5 μL of 10 μM primer mix in 50 μL volume using the following PCR protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... Gene specific primers with restriction sites added to the 5’ end were used to amplify the full CDS or gene fragments using Q5 DNA Polymerase (NEB). Primer sequences and restriction sites used for each construct can be found in Table S8 ...
-
bioRxiv - Genomics 2021Quote: ... Array DNA used in directed methylation experiments was then biotinylated by filling in EcoRI and XbaI 5’overhangs with dGTP (NEB), α-thio-dCTP (Chemcyte) ...
-
bioRxiv - Genomics 2021Quote: ... 95°C/15 s and annealing/extension: 65°C/5 min) of PCR using Q5 high-fidelity DNA polymerase (NEB). Amplicons were purified using 1× AMPure XP beads (Beckman Coulter) ...
-
bioRxiv - Genomics 2020Quote: ... RNA was ligated overnight at 16°C at 5’ with DNA/RNA chimeric oligonucleotide adaptor (TCAGACGTGTGCTCTTCCGATCTrNrNrWrNrNrWrNrN, TIF2-RNA in Supplementary Table S1 using T4 RNA ligase (NEB) in the presence of 10% dimethylsulphoxide (DMSO) ...
-
bioRxiv - Cell Biology 2020Quote: ... pCS2-luciferase CDS or pCS2-luciferase with G3BP1 5’UTR and 3’UTR were linearized with Sal I (New England Biolabs) and gel purified (Qiagen) ...
-
bioRxiv - Cell Biology 2021Quote: ... Crosslinked cells were washed twitch with phosphate buffered saline (PBS) contains 5% vanadyl complex (New England Biolabs, Cat. No. S1492S) and 1 mM Phenylmethanesulfonyl fluoride (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2022Quote: ... The 3’ends of end-repaired DNA were extended with an A-overhang with 3’ to 5’ exonuclease-deficient Klenow DNA polymerase (NEB). The resulting fragments were ligated to Nextflex adapters (Bio Scientific ...
-
bioRxiv - Biochemistry 2022Quote: ... The supernatant was then transferred to a fresh low-bind tube containing pre-washed 5 µl amylose magnetic beads (NEB) and rotated for 45 min at 4 °C ...
-
bioRxiv - Genetics 2022Quote: ... The resulting monophosphorylated RNAs were ligated to the 3’ adaptor (5’rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’, IDT) using T4 RNA ligase 2 in the presence of 25% PEG8000 (NEB) at 15 °C overnight ...
-
bioRxiv - Molecular Biology 2022Quote: ... on-bead decapping and phosphorylation were performed in a 30 μl reaction with 5 units T4 PNK 3’ phosphatase minus (NEB), 2.25 μg GST-Dcp1-Edc1-Dcp2 ...
-
bioRxiv - Microbiology 2022Quote: ... Radioactive probe was prepared using 40 pmol of primer 59 and 5’-labelled with 10 U of T4 Polynucleotide Kinase (New England Biolabs) and [γ32P]ATP (150 μCi) ...