Labshake search
Citations for New England Biolabs :
1451 - 1500 of 9609 citations for Mouse Switch associated protein 70 SWAP70 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2023Quote: ... The glutathione or amylose agarose was then washed 5-10 times to remove unbound proteins before boiling and analysis by SDS-PAGE WB using anti-MBP (NEB) and anti-GST (abcam ...
-
bioRxiv - Synthetic Biology 2023Quote: ... was then done with the homologies to construct the initial green fluorescent protein (GFP) plasmid and then transformed into competent E.coli (NEB#C2984H) and subsequently sequenced (Plasmidsaurus ...
-
bioRxiv - Molecular Biology 2023Quote: ... with GFP protein fused at C- terminal and NcoI restriction enzyme sites on both ends using Gibson Assembly (NEB, USA). Empty vector pCAMBIA 1302 was used as a positive control ...
-
bioRxiv - Plant Biology 2023Quote: ... into the pMAL-C2 vector and fusion proteins were expressed and purified using amylose-affinity chromatography as described by the manufacturer (New England Biolabs). The over-expressed recombinant proteins were then coupled to CNBr-activated Sepharose (Sigma ...
-
bioRxiv - Biochemistry 2023Quote: ... The protein was eluted at 100% Buffer F and protein fractions were pooled and combined with TEV and CIP (#M0525) from NEB and dialyzed overnight against Buffer E at 4 °C ...
-
bioRxiv - Biochemistry 2022Quote: Drosocin-ribosome complexes were generated by in vitro transcription-translation reactions in PURExpress ΔRF123 in vitro protein synthesis system (New England Biolabs) with the same reaction mix as described earlier in the toeprinting assays ...
-
bioRxiv - Biochemistry 2023Quote: ... Peptide bound beads were washed with 100 µL 1x lambda phosphatase buffer prior to incubating with lambda protein phosphatase (P0753; NEB).
-
bioRxiv - Cell Biology 2023Quote: ... The vector was transformed into BL21-DE3 cells and the protein purified using gravity flow amylose resin (New England Biolabs) affinity chromatography ...
-
bioRxiv - Synthetic Biology 2023Quote: Plasmids encoding RBC biosensor proteins were assembled using standard molecular biology techniques of PCR and restriction enzyme cloning with Phusion DNA Polymerase (NEB), restriction enzymes (NEB ...
-
bioRxiv - Cancer Biology 2023Quote: ... lysate volume equivalent to 20-40 µg total protein was first denatured at 100°C for 10 min in 1X glycoprotein denaturation buffer (NEB). Endo H digestion was performed at 37°C for 1h in the presence of 1X GlycoBuffer 3 and 1 µL of Endo H enzyme (NEB) ...
-
bioRxiv - Plant Biology 2023Quote: ... and AT1G66100 which encode a PR (pathogenesis-related) protein were amplified using the Phusion High-Fidelity DNA Polymerase (New England Biolabs) from Col-0 genomic DNA with two primer pairs RBCS2B-BglII-PF (5′-CCAGATCTGGAATATTCAATGTTGACTATC-3′ ...
-
bioRxiv - Biochemistry 2023Quote: ... Cleared lysate containing the nucleosomes was incubated with purified MBP-tag or MBP-FoxP3ΔN protein (1uM) for 1 hour at 4℃ and then subjected to MBP pulldown using Amylose Resin (New England Biolabs). After proteinase K (New England Biolabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... TIS11B protein-RNA complexes were immunoprecipitated from 1 ml of crosslinked lysate and washed with high salt and PNK buffer (NEB). RNA was repaired by 3′ dephosphorylation and ligated to L3-IR adaptor on beads ...
-
bioRxiv - Molecular Biology 2023Quote: Expression vectors encoding His6/SUMO-tagged SAHS proteins were obtained from Twist Bioscience and transformed into LEMO21(DE3) competent cells (New England Biolabs) according to the provider’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... Coli vectors expressing SAHS proteins without SUMO tags were ordered and synthesized from Twist Bioscience and transformed into LEMO21(DE3) competent cells (NEB). To test for the effects of intracellular SAHS expression ...
-
bioRxiv - Cell Biology 2023Quote: ... myc-tagged AP3B1 immunoprecipitated and immobilised on Protein G-sepharose beads was incubated with CK2 (250 units; New England Biolabs) for 30 min ...
-
bioRxiv - Cell Biology 2023Quote: ... the reaction was stopped with a final concentration of 50 mM EDTA and the proteins were removed by treatment with proteinase K (1/100 of the volume – NEB) and SDS (0.1% ...
-
bioRxiv - Genomics 2024Quote: Each of the fragmented protein factor-enriched chromatin sample was mixed with 50 µg/ml of BSA (cat# B9000S, NEB) to prevent chromatin aggregation ...
-
bioRxiv - Plant Biology 2024Quote: ... in an N-terminal fusion (MIROs are tail anchored proteins) with mCherry that was generated by Gibson assembly (New England Biolabs, Ipswich ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 40 – 50 µg of protein lysate from each sample was denatured in 1X Glycoprotein Denaturing Buffer (Cat.#B1704S; New England Biolabs) with 20 µL total volume at 100°C for 10 min ...
-
bioRxiv - Cell Biology 2024Quote: ... under a CamKII promoter were both restriction digested with AgeI and the HALO protein was ligated with Quick Ligase (NEB) into the ER-GCaMP yielding the CamKII ER-Halo-GCaMP6-150 ...
-
bioRxiv - Biochemistry 2024Quote: ... a pET-derived vector that is normally used for T7 RNA polymerase-dependent protein expression (AVA421) was linearized by digestion with XbaI (NEB) in a reaction containing 1X CutSmart buffer and 0.5 U/μl XbaI to be used for run-off transcription using T7 RNA polymerase to transcribe the first 26 nucleotides following the T7 promoter sequence to generate the standard model RNA substrate ...
-
bioRxiv - Bioengineering 2024Quote: ... and mCherry inserts were generated via PCR and cloned into the linearized viral backbone as a single fusion protein using HiFi cloning mix (NEB). H2B-iRFP nuclear marker was (Addgene Plasmid #90237) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Template DNA for in vitro protein synthesis was generated with Phusion® Hot Start Flex DNA Polymerase (NEB. Ipswich MA) using gBlocks as template and flanking primers (Supplementary Table S2) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... were prepared using the NEBNext Ultra II DNA Prep Kit following the published protocol for this kit (New England Biolabs, Ipswitch, MA, USA), and quantified using an Agilent Bioanalyzer 2100 DNA 1000 kit (Agilent Technologies ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... we isolated DNA from tissue using the Qiagen DNeasy Blood and Tissue kit (Valencia, CA, USA) and created genomic libraries using the NEBNext Ultra II kit (New England BioLabs; Ipswich, MA, USA), according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... to evaluate the performance of our library preparation protocol – TM3’seq – and compare it to the performance of a commercial kit commonly used to generate RNA-seq libraries – NEBNext® Ultra™ Directional RNA kit (NEB, #E7420S). Three replicates of 200ng total RNA per tissue (blood and adipocyte ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Cloning was carried out using the Gibson Assembly® Master Mix kit and NEBuilder® HiFi DNA Assembly kit (New England Biolabs, US). Genomic DNA was prepared by the Blood & Cell Culture DNA Kit (QIAGEN ...
-
bioRxiv - Genomics 2020Quote: ... The first step involved incubation of total DNA with proteinA-MBD2-Fc mixture (NEBNext Microbiome DNA Enrichment Kit, New England BioLabs, Microbial enrichment kit, New England Biolabs, Cat No. E2612L), which binds and depletes methylated nuclear DNA fragments ...
-
bioRxiv - Microbiology 2021Quote: ... gDNA harvested with the Masterpure Complete DNA/RNA Purification Kit was bisulfite treated using the EpiMark Bisulfite Conversion kit (NEB; Ipswich, MA, USA); both per manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... rRNA was depleted from total RNA using Ribo-Zero™ rRNA removal Kit and library was made using Illumina NEBNext® Ultra™ Directional RNA Library Prep Kit (E7420L, NEB). The libraries were loaded on an Illumina HiSeq X ten instrument (Illumina) ...
-
bioRxiv - Genomics 2021Quote: ... gDNA was extracted from 1 ml of overnight culture with the kit Monarch HMW DNA Extraction kit (T#3060 New England Biolabs; Ipswich, MA, USA) following the manufacturer instructions for High Molecular Weight DNA extraction from gram-negative bacteria ...
-
bioRxiv - Plant Biology 2023Quote: Libraries for each sample were prepared using the NEBNext Ultra II DNA Library Prep Kit and NEBNext Muliplex Oligos for Illumina Kits (New England Biolabs, Ipswich, Massachusetts, USA) following the NEBNext Ultra II Version 5 protocol with size selection on DNA fragments at 300-400bp range ...
-
bioRxiv - Genomics 2023Quote: ... Two libraries were prepared for Nanopore MinION sequencing using the Ligation Sequencing kit (SQK-LSK108, ONT, Oxford, UK) and NEBnext DNA Repair kit reagents (NEB, Ipswich, MA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: The novel entry modules created for this study were cloned by insertion of PCR-amplified sequences in pJet1.3 or pMiniT 2.0 following manufacturer’s instructions (CloneJET PCR Cloning Kit, Thermo Scientific; NEB® PCR Cloning Kit, NEB). BsaI recognition sites followed by module-specific overhangs were added to each primer used to amplify entry sequences ...
-
bioRxiv - Genetics 2024Quote: ... The fragmented samples were purified with Expin™ PCR SV kit (GeneAll) and prepared as an NGS library with NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (NEB). The prepared samples were sequenced with MiniSeq High Output Reagent Kit (300-cycles ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bound antibodies were detected by incubation with anti-rabbit or anti-mouse DyLight 800-conjugated secondary antibodies (New England BioLabs). Slide images were acquired using an InnoScan 710-IR scanner (Innopsys ...
-
bioRxiv - Immunology 2021Quote: ... A mouse SUV39H1 gBlock was synthesized (IDT) and cloned into AgeI/BSpEI-digested pL-SFFV-RFP using Gibson assembly (NEB) for 1hour at 50°C ...
-
bioRxiv - Cell Biology 2022Quote: The DNA sequence coding for full length of p21 and Cyclin B1 was amplified from mouse cDNA by PCR using Phusion high-fidelity DNA Polymerase (New England BioLabs) and cloned in frame into Ch plasmid with AsiSI and NotI restriction endonucleases (New England BioLabs) ...
-
bioRxiv - Genomics 2020Quote: ... The protocol started with tissue pre-permeabilization (30 min at 33°C for mouse brain) with addition of 120μl reagent per well of exonuclease I buffer (NEB, USA). In case spleen sections were processed ...
-
bioRxiv - Neuroscience 2019Quote: ... Secondary antibodies used were: Alexa-680 goat anti-mouse IgG and Alexa-800 goat anti-rabbit IgG (New England Biolabs). For DRGN cultures ...
-
bioRxiv - Cancer Biology 2022Quote: The CAG-HA-RBMS3-PCDH cDNA expression plasmid was cloned using a cDNA template made from RNA from the lungs of a wild-type mouse using the Q5 polymerase (NEB) and restriction endonuclease cloning with the following primers ...
-
bioRxiv - Neuroscience 2021Quote: ... One piece of mouse frontal cortex tissue (6-10 mg) was placed in 3 ml of ice-cold nuclei extraction buffer (NEB) [0.32 M sucrose ...
-
bioRxiv - Developmental Biology 2021Quote: Subcloning Both full-length and truncated (1-160) mouse Naa12 were amplified from the pMAL-c5x Naa12 plasmid using Q5 HF Master Mix (NEB), AAAACCCGGGTATGAACATCCGCCGGGCTCGGC as the forward primer ...
-
bioRxiv - Cell Biology 2019Quote: ... Standard qualitative PCRs to check for the general abundance of distinct SPIRE1 splice variants were performed employing cDNAs from mouse brain tissue and Q5 High-Fidelity DNA polymerase (New England Biolabs). Expression vectors encoding mouse SPIRE1 ...
-
bioRxiv - Immunology 2020Quote: ... Single antigen specific memory B cells were sorted on BD FACS Aria II into 96-well PCR plates (Axygen) containing 10 μl per well of lysis buffer (10 mM DPBS, 4 U Mouse RNase Inhibitor, NEB). Plates were immediately frozen on dry ice and stored at 80 C or processed for cDNA synthesis.
-
bioRxiv - Neuroscience 2023Quote: ... To generate these constructs gene block fragments that codify for those sequences were produced in the Duke Transgenic Mouse Facility and cloned into the backbone using EcoRI-HF Restriction Enzyme (NEB) and In-Fusion HD Cloning Kit (Takara ...
-
bioRxiv - Immunology 2023Quote: ... The custom sgRNA vector used in this study was a hybrid AAV-SB-CRISPR plasmid for targeting primary mouse NK cells (AAV-SB100x) that was constructed by gBlock fragments (IDT) followed by Gibson Assembly (NEB). The Surf-v2 library was cloned into the AAV-SB-CRISPR vector by pooled cloning to generate the AAV-SB-Surf-v2 plasmid library.
-
bioRxiv - Molecular Biology 2023Quote: ... The corresponding regions of a partial mouse Azin1 gene were amplified from mouse tail genomic DNA by using Phusion Hot Start Flex 2X Master Mix (New England Biolabs) and the following primers ...
-
bioRxiv - Molecular Biology 2019Quote: ... of pA-Dam protein was incubated with 500 ng of unmethylated plasmid in 20 µL of 1x dam MethylTransferase buffer (New England BioLabs #M0222S) supplemented with 80 µM S-adenosylmethionine (SAM ...