Labshake search
Citations for New England Biolabs :
1451 - 1500 of 2049 citations for 6 Benzyloxy 1H indole 2 boronic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... the cap-1 structure was added using the vaccinia virus capping enzyme and 2 -O-methyltransferase (New England Biolabs). The mRNA was purified by oligo-dT affinity purification ...
-
bioRxiv - Molecular Biology 2022Quote: ... doner RNA and the complementary splint DNA strand were annealed at a molar ratio of 1: 2: 1.5 in T4 DNA ligase buffer (NEB) by incubation for 3 min at 65°C ...
-
bioRxiv - Microbiology 2022Quote: ... Conventional PCR assays were carried out with Q5 Hot Start High-Fidelity 2× Master Mix (New England Biolabs, Australia). For some samples ...
-
bioRxiv - Genomics 2022Quote: ... then A-tailed by incubating for 1 h at 37°C with 200 μM dATP and 0.2 U/μL Klenow fragment (3’-5’ exo-) in NEBuffer 2 (NEB), then Illumina PE adapter was added by incubating overnight at 20°C with 15 μM PE adapter and 2000 U T4 DNA ligase in ligase buffer ...
-
bioRxiv - Plant Biology 2022Quote: ... we first created a RUBY-minus vector lacking the gene GT by assembling PCR product 1 containing CYP76AD1 and DODA and PCR product 2 containing Arabidopsis HSP18.2 terminator into a pGFPGUSplus vector 18 via NEBuilder HiFi DNA Assembly (New England BioLabs). The pAXY0006 vector of split-RUBY was generated by assembling PCR products containing f1 fragment of gene GT (named GTf1 ...
-
bioRxiv - Neuroscience 2022Quote: ... RNP complex were generated by mixing 1 μg of sgRNA with 2 μM of EnGen SpyCas9 NLS (NEB, M0646) at room temperature for 15-20 min ...
-
bioRxiv - Microbiology 2022Quote: ... the cap-1 structure was added using the vaccinia virus capping enzyme and 2’-O-methyltransferase (New England Biolabs). The mRNA was purified by oligo-dT affinity purification ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 μL i7 unique index primer (10 μM) and 25 μL NEBNext High-Fidelity 2X PCR Master Mix (NEB) were added to 21 μl of purified CUT&TAG DNA ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 20 µL of denatured protein lysate was combined with 2.6 µL of 10X GlycoBuffer 2 (Cat.#B3704S; New England Biolabs), 2.6 µL of 10% NP-40 (Cat.#B2704S ...
-
bioRxiv - Microbiology 2024Quote: ... 1 µL of isolated phage T4 in Pi-Mg buffer was used as a PCR template in the first PCR with the following reaction mix: 0.125 µM each primer (Supplementary Table 2) in 1x High Fidelity Master Mix (NEB) with a total volume of 10 µl ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.01 pmol (2:1 molar ratio of insert:backbone) library and 2.5 uL NEBuilder HiFi DNA Assembly Master Mix (NEB E2621) and incubated at 50 °C for 60 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μL of PURExpress sample was mixed with 300 ng of ΦX174 Virion DNA (ssDNA substrate, NEB Ipswich MA) or ΦX174 RF I DNA (dsDNA substrate ...
-
bioRxiv - Developmental Biology 2024Quote: ... Cells were fixed with 3% paraformaldehyde in PBS for 10 min at room temperature and permeabilized with ice-cold permeabilization buffer (1X-PBS, 0.5% Triton X-100, 2 mM vanadyl-ribonucleoside complex (New England Biolabs)) for 4 min on ice ...
-
bioRxiv - Bioengineering 2024Quote: ... The RNA template of the SARS-CoV-2 N gene was synthesised using in-vitro transcription (Hiscribe, NEB, US) and a template plasmid (Molecular Diagnostics Collection ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR reactions contained 2 μl cDNA in 50 μl PCR reaction with Phusion Hot Start Flex (New England Biolabs). Reaction conditions ...
-
bioRxiv - Genetics 2023Quote: ... The PCR reaction was performed using NEBNext® High-Fidelity 2× PCR Master Mix (New England BioLabs, catalog #M0541) with a reaction volume of 10 ul including 5 ul 2× PCR Master Mix ...
-
bioRxiv - Biophysics 2023Quote: ... and DNA-bound proteins were released by MNase treatment (2 min 30° with 700 units of MNase NEB # M0247S) and analyzed by gel electrophoresis40.
-
bioRxiv - Microbiology 2023Quote: ... Annealing was performed with 4 µM (final) of each guide oligo and 0.5-2 µg of template DNA in 1x Cutsmart buffer (NEB) using a slow temperature gradient (95°C – 60°C at 0.1°C / sec ...
-
bioRxiv - Molecular Biology 2023Quote: ... Homology fragments were assembled using the NEBuilder® 2 X HiFi DNA assembly master mix (NEB, Cat. No. #E2621), while guide RNAs were inserted by ligation using T4 ligase (NEB ...
-
bioRxiv - Biophysics 2023Quote: ... We digested the cosmid-i95 for 2 h at 37°C using SpeI-HF restriction enzyme (New England Biolabs) and heat-inactivated for 20 min at 80°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 7.5 µL DNA was incubated (14 h, 37°C) with IVT mix (0.5 µL Ribolock inhibitor, Invitrogen, 2 µL T7 polymerase buffer, NEB, 8 µL rNTP mix ...
-
bioRxiv - Genomics 2023Quote: ... or 40,000 nuclei per well in 22 µL of NSB and 2 µL of 10 mM dNTP mix (NEB).
-
bioRxiv - Evolutionary Biology 2023Quote: ... All mutants (Arp2D subdomain 2 swap, Arp2D-2CT, and Arp2-2DCT) were generated using Q5 site-directed mutagenesis (NEB). All genes were cloned into a vector encoding an attB site and superfolder GFP under the control of an eye-specific promoter (3XP3) ...
-
bioRxiv - Developmental Biology 2023Quote: ... A primer set annealing to the amplification sequences was used at a final concentration of 0.5 μM to amplify the pool of oligonucleotides using 12.5 μL 2 x NEBnext PCR master mix (New England BioLabs) and 3 μL of oligonucleotide pool (∼3 ng) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 μl of iTP_3’_linker_ApoI (10 μM) and 0.5 μl of ligase (T4 RNA ligase 2, truncated - 200 000 U/ml - New England Biolabs) per reaction ...
-
bioRxiv - Biochemistry 2023Quote: Approximately 100 µg of extracted protein was incubated with 2 µL (1,000 U) of PNGase F (New England Biolabs) at 37°C for 48 hrs ...
-
bioRxiv - Genetics 2023Quote: ... Input genomic DNA was first amplified in a 10μL reaction for 30 cycles using NEBNext High-Fidelity 2×PCR Master Mix (NEB). Amplicons were purified using AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 µL i7 unique index primer (10 µM) and 25 µL NEBNext High-Fidelity 2X PCR Master Mix (NEB) and subjected to the following PCR program ...
-
bioRxiv - Microbiology 2023Quote: The pGEX-6P-PrkA1-338 plasmid (Table 2) was constructed by a two-part ligation (NEB Quick Ligation kit) of BamHI- and NotI-linearized pGEX-6P and PCR-generated prkA1-338 amplified with primers AS21 and AS81 (Table 3 ...
-
bioRxiv - Genomics 2023Quote: ... we amplified pegRNA/ngRNA pair sequences from each sample using NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L) and the following primers ...
-
bioRxiv - Cancer Biology 2023Quote: ... To produce the ABI1 Isoform 2 deleted SH3 domain we performed Q5 site-directed mutagenesis (New England Biolabs Inc.) with forward primer 5’-TAGCTCGAGGTTAACGAATTC - 3’ and reverse primer 5’-TTTCTCAATATAATTCTTGGGG - 3’ synthesized by IDT and then verified the sequence (Genewiz) ...
-
bioRxiv - Microbiology 2023Quote: ... Amplified PCR products were ran on 2% agarose gel and stained with ethidium bromide solution (New England Biolabs Inc.). Gel photographs were taken using ChemiDoc MP gel documentation system (BIO-RAD).
-
bioRxiv - Microbiology 2023Quote: ... was ordered and cloned into the pCG1-SARS-2BA.2 vector via Gibson assembly according to the manufacturer’s instructions (New England Biolabs). To this end the pCG1-SARS-2-BA.2 vector was amplified by PCR using appropriate primers (GTGCCATTGGTGCCGGACACG and CACCAGCCTTACAGAGTGG ...
-
bioRxiv - Biochemistry 2023Quote: IVT and co-transcriptional capping reactions were performed in 30 μL reactions containing 1x T7 RNA polymerase buffer (40 mM Tris-HCl, 20 mM MgCl2, 1 mM DTT, 2 mM spermidine, pH 7.9; New England Biolabs), 5 mM each NTPs ...
-
bioRxiv - Molecular Biology 2023Quote: ... Barcoded 3’ adapters (see Extended Data Table 1) were ligated using K227Q truncated T4 RNA ligase 2 (NEB, M0351L) at a concentration of 0.5 µM adapter and in the presence of 25% PEG8000 containing a homemade 10 x ligation buffer (0.5 M Tris pH 7.8 ...
-
bioRxiv - Bioengineering 2023Quote: ... and assembled with PCR amplified (primers 2 and 3) pRSET vector fragment using Gibson assembly (NEB Japan, Tokyo, Japan) to add T7 promoter ...
-
bioRxiv - Neuroscience 2023Quote: ... mRNA Magnetic Isolation Module and NEBNext Multiplex Oligos for Illumina (Index Primers Set 1/2/3/4) following the manufacturer’s instructions (New England Biolabs). Quantification and quality checked of libraries was done using an Bioanalyzer 2100 instrument and DNA 7500 kit (Agilent Technologies) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 0.5 μl of 100 mM phenylmethylsulfonyl fluoride] and incubated with micrococcal nuclease (2 × 103 U/ml; New England Biolabs) for 2 hours at 4°C ...
-
bioRxiv - Immunology 2023Quote: ... Single cells of two untreated CeD patients were sorted into 96-well plates containing 2 µl of scRNA-seq catch buffer (0.2% vol/vol Triton X-100 [Sigma] in H2O with 2 U/μl RNase inhibitor [New England Biolabs]) per well using a FACSAriaIII instrument (BD) ...
-
bioRxiv - Microbiology 2023Quote: ... by mixing 2 ul 1:10.000 diluted library with 8 ul Quant mastermix with added primers (New England Biolabs). Due to low initial concentration of adapter ligated product we made triplicates of the library ...
-
bioRxiv - Immunology 2023Quote: ... and ligated with custom UMI adapters (IDT) (Table S2) at 2 uM according to NEBNext Ultra II instructions (NEB). Libraries were prepped following NEBNext Immune Sequencing Kit’s protocol (NEB) ...
-
bioRxiv - Plant Biology 2023Quote: ... PCR products were digested with 0.4 μl of restriction enzyme NlaIII for 2 hours at 37°C (New England Biolabs). Digested PCR products were run on 2% agarose gels with SYBR Safe (Invitrogen ...
-
bioRxiv - Developmental Biology 2023Quote: ... for the elution from the columns 2 pg of Tn5-digested and purified lambda DNA (New England Biolabs, # N3011S) were added to be used as spike-in normalizer for later analysis ...
-
bioRxiv - Synthetic Biology 2024Quote: ... up to 2 μg of plasmid DNA was incubated for 4 h at 37°C with 2 μl of CpG Methyltransferase from M.SssI (NEB) in the Methyltransferase Reaction Buffer supplemented with 2 μl of diluted SAM (6.4 mM) ...
-
bioRxiv - Bioengineering 2024Quote: S-R1-R2-H stock (87.5 kDa, 2 - 4 μM) tagged with handle oligos was reconstituted in 1x T4 ligase buffer (NEB) in PBS with 0.05% NP-40 ...
-
bioRxiv - Immunology 2024Quote: ... Samples were then processed for library barcoding and amplification with Q5 High-Fidelity 2× Master Mix (cat. M0492S, NEB). Prepared libraries were sent for sequencing after quantification using Qubit and size distribution as determined using an Agilent 4200 TapeStation.
-
bioRxiv - Microbiology 2024Quote: ... The RT RNA sample (5 μL) was amplified using the LongAmp Taq 2× Master Mix (NEB, Ipswich, MA, USA) with IVT Nanopore T7 Fw and IVT Nanopore T7 Rv primers (Supplementary Table 5) ...
-
bioRxiv - Cell Biology 2024Quote: ... 100 pmol forward oligo and 100 pmol reverse oligo were resuspended in 25 μL 1x NEBuffer 2 (NEB, B7002S). The solution was incubated in a 95 °C water bath for 4 min then slowly cooled (∼0.5 °C/min ...
-
bioRxiv - Genomics 2024Quote: ... 2 µg of the plasmids containing the reporters and promoters (pJL206 or pJL261) were linearized with BciVI (NEB, R0596S) for 1 h at 37 °C ...
-
bioRxiv - Biochemistry 2024Quote: ... The reaction mix was incubated at 37°C and 15 ul aliquots were removed at indicated time points, quenched into stop buffer (1.8% SDS, 10 mM EDTA) followed by Proteinase-K (2 units total) (NEB) treatment for 45 min at 50°C ...