Labshake search
Citations for New England Biolabs :
1451 - 1500 of 1736 citations for 2 Iodomethyl tetrahydrofuran since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... All others cloning were classically performed by vector and PCR products restriction for 2 hours at 37°C in Cutsmart Buffer (New England Biolabs) with appropriate restrictions enzymes (BamHI ...
-
bioRxiv - Microbiology 2024Quote: ... A 20 µL Gibson Assembly reaction was performed with 50 ng of vector at a 2:1 ratio for 1 hour (New England Biolabs NEBuilder HiFi DNA Assembly Master Mix ...
-
bioRxiv - Genetics 2024Quote: ... The 24 μl of dA-tailed DNA and 2 μl of ligation adapter were ligated using 4 μl of Quick T4 DNA Ligase (New England Biolabs) in 40 μl of reaction volume ...
-
bioRxiv - Microbiology 2024Quote: ... And a positive control reaction was performed where lysate was substituted with 2 µL (20 U) of purified Exonuclease I (NEB). Reactions were allowed to incubate for 1 min at room temperature ...
-
bioRxiv - Immunology 2024Quote: ... supplemented with recombinant human IL-2 (rhIL2, 10 U/ml, Miltenyi) and Dnase I (1 U/ml, New England Biolabs). Cells were washed and 5-9 x 106 PBMCs were then seeded/well in a 24-well plate in IMDM supplemented with 10 % SAB ...
-
bioRxiv - Neuroscience 2024Quote: ... Libraries were barcoded using NEBNext Multiplex Oligos for Illumina (Index Primers Set 1 and Set 2) (NEB, E7335S and E7500S). Paired end sequencing was performed (S1 and S2 ...
-
bioRxiv - Microbiology 2024Quote: ... Diluted supernatants were used as the template DNA (5 μL) for qPCR using a 2×Luna universal qPCR master mix (New England BioLabs), with 0.5 μM of primers ...
-
bioRxiv - Neuroscience 2024Quote: ... The homology-directed repair (HDR) plasmid for C-terminal SAX-2::GFP(ju1831) was made using three-fragment Gibson Assembly (New England Biolabs) in which two sax-2 homology arms containing 498 bp upstream of the sax-2 TAA stop codon and 540 bp downstream of the sax-2 TAA stop codon plus the stop codon were amplified from N2 genomic DNA and fused such that they flanked GFP (pDD282) ...
-
bioRxiv - Immunology 2024Quote: ... and this point mutation introduces a premature stop codon and abolishes an Hpy118I site and the line was genotyped by PCR (primers in Table 2) and Hpy118I digest (NEB) (Supp Fig 1B) ...
-
bioRxiv - Immunology 2024Quote: ... The irf8 st95 mutation abolishes an AvaI restriction site and this line was genotyped by PCR (primers in Table 2) and AvaI digest (NEB), as previously described (Shiau et al. ...
-
bioRxiv - Molecular Biology 2024Quote: ... or 2μg (dual-guide) per well were set up using the Q5 Hot Start High-Fidelity 2× Master Mix (NEB #M0494) in a total volume of 50μl ...
-
bioRxiv - Biochemistry 2024Quote: ... pETDuet-1 vector was linearized by digestion with PacI and NdeI and gene fragments were inserted into multiple cloning site 2 (MCS2) of the linearized plasmid via Gibson assembly using the New England BioLabs (NEB) Gibson Assembly Master Mix and following the manufacturer’s standard protocol ...
-
bioRxiv - Plant Biology 2024Quote: ... 2 µg of total RNA was circularised in a reaction containing 6 U T4 RNA Ligase 1 (New England Biolabs), 50 µM ATP ...
-
bioRxiv - Biochemistry 2024Quote: ... The cDNA was diluted 1:50 in ddH2O and 2 µL used as a template in a 15 µL reaction using the Luna Universal qPCR Master Mix (NEB) on a Rotor-Gene Q (Qiagen) ...
-
bioRxiv - Microbiology 2024Quote: ... followed by excision and ligation for 2 hours at room temperature using the Instant Sticky-end Ligase Master Mix (NEB) in accordance with the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purified extension products were denatured and ligated to adaptor 2 (Ad2, Supplementary Table 3) by Instant Sticky-end Ligase Master Mix (New England Biolabs) at 4 °C overnight ...
-
bioRxiv - Molecular Biology 2024Quote: ... The NEBuilder Assembly Tool was used to design primers for amplification of each component of the donor plasmid (Table 2) using Phusion (NEB); purified PCR products were assembled using NEBuilder HiFi DNA Assembly Master Mix (NEB) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Deletion constructs were made by PCR amplification of the appropriate regions and cloned into the Cilantro 2 vector using Gibson cloning (New England Biolabs). Lentiviral particles carrying the respective constructs in the Cilantro 2 vector were produced and used to transduce MOLM-13 cells as described above ...
-
bioRxiv - Microbiology 2024Quote: ... The SARS-CoV-2 Spike coding region was then amplified using Q Hot Start High-Fidelity DNA Polymerase (New England Biolabs) with forward (5’ TCATCGATGCATGGTACGCCACCATGTTTGTTTTTCTTGTTTTATTG 3’ ...
-
bioRxiv - Microbiology 2024Quote: ... the RNA pellet was resuspended in 50 µl of RNase-free H2O and 1 µl of the resuspended samples was used for quantification of the DENV-2 D220 NS5 RNA regions using Luna Universal One-Step RT-qPCR Kit (New England Biolabs) in a 10-ul reaction volume ...
-
bioRxiv - Physiology 2024Quote: ... Separate sets of cells were also collected and frozen in RIPA buffer containing 2 mM activated sodium orthovanadate (Na3VO4) (New England Biolabs) and 1% protease inhibitor cocktail (MilliporeSigma ...
-
bioRxiv - Physiology 2024Quote: ... the following reagents were added to each tube containing 1 cell in ∼5 μL: 2 μL M-MuLV Reverse Transcriptase Reaction Buffer (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA of 2×106 cells was extracted with the Monarch Total RNA Miniprep Kit with “on column” DNase I treatment (NEB). cDNA was generated by using LunaScript RT SuperMix Kit (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 µg of RNA was reverse transcribed using the ProtoScript II Reverse transcriptase kit from New England Biolabs (NEB #M0368S) and primed with oligo dT ...
-
bioRxiv - Molecular Biology 2024Quote: ... 10 µg genomic DNA per sample was mock treated or treated with 2 U/µg DNA of RNaseH (NEB, M0297) for 2 h at 37 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 50 µL reactions were prepared for the second PCR by mixing 25 µL of 2× Phusion High-Fidelity PCR Master Mix (New England Biolabs), 15 µL of cleaned-up PCR product from the first PCR and 10 µL Nextera DNA CD Indexes (96-well format from Illumina ...
-
bioRxiv - Plant Biology 2024Quote: ... The OsXLG crRNA target sequences were amplified using gene-specific primers (SI, Table 2) and Q5 Hi-Fi DNA polymerase (NEB). The PCR amplicons were subjected to Sanger sequencing and analyzed using CRISP-ID online software (Dehairs et al. ...
-
bioRxiv - Microbiology 2024Quote: ... Site-directed mutagenesis was performed to engineer alanine or glutamic acid substitution mutations in Tax1bp1 using the primers listed in Table 2 and the Q5 site-directed mutagenesis kit (New England Biolabs). Open reading frames (ORFs ...
-
bioRxiv - Biophysics 2024Quote: ... We digested the pBS-parS for 2 h at 37°C using NotI-HF or XhoI restriction enzymes (New England Biolabs) and heat-inactivated for 20 min at 80°C ...
-
bioRxiv - Microbiology 2024Quote: ... and 1U RNasin) for 2 hours at 30°C and then incubated with 100 μL of Streptavidin Magnetic Beads (NEB) for 30 min at room temperature ...
-
bioRxiv - Genomics 2024Quote: ... the bead array was put into a 1.5 mL centrifuge tube of 200 µL extension buffer (1x NEBuffer 2, 1mM dNTP, 25 units Klenow exo- (NEB M0212L)) ...
-
bioRxiv - Genomics 2024Quote: ... with a final extension of 72°C for 2 min using Q5 Hot Start High-Fidelity DNA Polymerase (NEB M0493L). PCR reactions were purified by PCR cleanup beads (UC Berkeley DNA Sequencing Facility ...
-
bioRxiv - Genomics 2024Quote: ... 2 µL of 10X T4 Ligase Buffer and 1 µL of NEB Golden Gate Assembly Kit (NEB, catalog no. E1602L) with 65 cycles of digestion at 42°C and ligation at 16°C for 5 min each ...
-
bioRxiv - Biophysics 2024Quote: The extracted genomic DNA was then subjected to NGS library preparation through a two-step PCR process using Q5 High-Fidelity 2× Master Mix (New England Biolabs). The first PCR step involved amplifying the genomic loci and attaching adapter sequences (primers listed in Table S10) ...
-
bioRxiv - Synthetic Biology 2024Quote: pDC011 variants with gRNAs that target the loci (Supplementary Table 2) were generated by Golden Gate assembly using AarI and T4 DNA Ligase (NEB). pDC011 is a derivative of pSL2680 (Ungerer & Pakrasi ...
-
bioRxiv - Biophysics 2024Quote: ... was obtained as previously described.2 Mutagenesis to produce additional isoforms and mutants was performed using the Q5 Site Directed Mutagenesis Kit (New England Biolabs). 1N4R tau was generated using by an initial round of mutagenesis with primers (5’-CTGAAGAAGCAGGCATTGG-3’ and 5’-CTTCCGCTGTTGGAGTGC-3’ ...
-
bioRxiv - Biochemistry 2024Quote: ... 66 °C for 30 s, 72 °C for 30 s; and 72 °C for 2 min; Q5 Hot Start DNA polymerase [NEB]). PCR1 product was purified by SPRI beads (Mag-Bind TotalPure NGS ...
-
bioRxiv - Bioengineering 2024Quote: ... Cap-1 structures were then generated using the Vaccinia Capping System in conjunction with mRNA cap 2’-O-methyltransferase (both from New England Biolabs) for 45 minutes at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... then 30 μl denatured lysate were treated with 2 μl Endo H or 1 μl PNGase F enzymes (New England Biolabs) in 40 μl reactions according to the manufacturer instructions ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... libraries were amplified with NEBNext® Multiplex Oligos for Illumina® (Dual Index Primers Set 2) (New England Biolabs E7780) and KAPA HiFi HotStart ReadyMix (KAPA Biosystems KK2601) ...
-
bioRxiv - Biophysics 2021Quote: ... The Biotin-handle and Cosmid-I95 DNA were both digested for 2 hours at 37°C with SpeI-HF (NEB, R3133L) and subsequently heat inactivated for 20 minutes at 80°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... The calibrated small RNA samples were ligated to an adenylated and fluorescently labeled 3’ adaptor using T4 RNA ligase 2 truncated KQ (NEB, M0373S) and were subsequently separated on a 12% polyacrylamide UREA gel ...
-
bioRxiv - Evolutionary Biology 2021Quote: 5’ adapter ligation was performed by adding 3 uL of 10uM 5’ adaptor (which was previously denatured by heating to 70 C for 2 minutes and placed on ice, NEB E7330L), 2 uL of 10X T4 RNA ligation buffer (NEB B0216L) ...
-
bioRxiv - Neuroscience 2021Quote: ... PCR products were run on 2% agarose gels and the Quick load 100pb DNA ladder (New England Biolabs Inc., Ipswich, MA) was used for fragment size visualization ...
-
bioRxiv - Molecular Biology 2021Quote: ... All these reactions were performed in a single step by adding 2 µL of enzyme mix (1 µL of Thermolabile USER II (New England Biolabs, M5508L), 0.5 µL of Exonuclease I (New England Biolabs ...
-
bioRxiv - Molecular Biology 2020Quote: ... The plug was equilibrated with 100 μl CutSmart buffer containing 5 mM DTT and 1 mM dATP for 1 hour at room temperature before incubation for 2 h at 37°C in another 100 μl of the same buffer containing 1 μl Klenow exo-(NEB M0212S) and 1 μl T4 PNK (NEB M0201S) ...
-
bioRxiv - Physiology 2020Quote: ... Germany) 1.5% agarose gel using purple gel loading dye and 2-Log DNA ladder (both New England Biolabs, Ipswich, MA, USA) at 80 V and 85 mA for 2h ...
-
bioRxiv - Biochemistry 2020Quote: ... Cross-links were reversed from eluted chromatin by adding 6 μL of 5 M NaCl and 2 μL Proteinase K (NEB; P8107S) and incubation overnight at 65°C ...
-
bioRxiv - Biochemistry 2020Quote: ... Beads were resuspended in 1 volume of buffer A / 300 mM NaCl / 2 mM MnCl2 / 1 mM DTT and incubated with λ protein phosphatase (NEB) at 50 U / mL for 1 hour at 23°C with agitation ...
-
bioRxiv - Biochemistry 2020Quote: ... 1.5 mg of pNL003 plasmid (38) was linearized by incubation at 37 °C for 2-4 h in the presence of EcoRV (NEB R0195S). Transcription reactions (10 mL ...