Labshake search
Citations for New England Biolabs :
101 - 150 of 6017 citations for Type 1 Angiotensin II Receptor AGTR1 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... reverse transcribed using protoscript II (NEB) and RT primer oBZ408 (/5Phos/RNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC/iSP18/TTC AGACGTGTGCTCTTCCGATCTGTCCTTGGTGCCCGAGTG) ...
-
bioRxiv - Bioengineering 2019Quote: ... isothermal buffer II (NEB, Ipswich, MA), betaine (Millipore Sigma ...
-
bioRxiv - Biochemistry 2022Quote: ... 50 units/ml Dpn II (NEB) in RE buffer ...
-
bioRxiv - Plant Biology 2023Quote: ... ProtoScript II reverse transcriptase from NEB was used to generate cDNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... then USER II enzyme (NEB, M5509) was added to cleave the product followed by a second column purification (Zymo research ...
-
bioRxiv - Biochemistry 2023Quote: ... pomatia RNA with Protoscript II (NEB) and random primers ...
-
bioRxiv - Biophysics 2020Quote: Recombinant wild-type human histone H1.0 (New England Biolabs, cat. # M2501S) was used for experiments with fluorescently-labeled nucleosomes ...
-
bioRxiv - Bioengineering 2023Quote: ... Remnant wild-type DNA was degraded via DPN1 (New England Biolabs) digestion for two hours at 37°C ...
-
bioRxiv - Immunology 2021Quote: ... 1 µL of ProtoScript II reverse transcriptase 200 U / µL (cat. n° M0314L NEB, New England Biolabs, USA), 2 µL of random primer mix 60 µM (cat ...
-
bioRxiv - Immunology 2021Quote: ... 1 µL of ProtoScript II reverse transcriptase 200 U / µL (cat. n° M0314L NEB, New England Biolabs, USA), 2 µL of random primer mix 60 µM (cat ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: Up to 1 μg of DNA-free RNA was reverse transcribed using ProtoScript II Reverse Transcriptase (NEB, M0368), and anchored oligo-dT primers according to product instructions.
-
bioRxiv - Microbiology 2020Quote: ... 1 μg of RNA was used for cDNA synthesis using the ProtoScript® II kit (New England BioLabs). qPCR reactions were carried out with FastStart Essential DNA Green Master (Roche ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Up to 1 μg of DNA-free RNA was reverse transcribed using ProtoScript II Reverse Transcriptase (NEB, M0368) and anchored oligo dT primers according to the product instructions.
-
bioRxiv - Synthetic Biology 2021Quote: ... 1 μ L of Protoscript II Reverse Transcriptase (200U/μ L, Catalog No. M0368, New England BioLabs Inc.), 2 μ L of 0.1M dithiothreitol (DTT) ...
-
bioRxiv - Genomics 2023Quote: ... LIDAR-3_RT_antisense was digested by adding 1 μL of USER II enzyme (New England Biolabs, Cat. No M5508S) and incubating at 37°C for 30 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... Primary mouse antibodies against MBP (NEB E8032L, 1:5000) and RAD51 (Novus Biologicals 14b4 ...
-
bioRxiv - Neuroscience 2022Quote: ... and probed with p62 antibody (NEB D5L7G, 1:800) and streptavidin-594 (Biolegend 405240 ...
-
bioRxiv - Cell Biology 2020Quote: ... were reinjected at 75 μl/h and co-flowed with 150 μl/h PCR mix (1.65x NEBNext Ultra II Q5 Master Mix, 0.033 U/μl USER II (NEB), 1.32 M Propylene glycol ...
-
bioRxiv - Genomics 2022Quote: ... Ultra II End-prep reaction buffer (NEB) and Ultra II End-prep enzyme mix (NEB ...
-
bioRxiv - Genomics 2019Quote: ... NEBNext Ultra II Q5 Master Mix (NEB) was used to amplify diluted poly(G/I ...
-
bioRxiv - Plant Biology 2021Quote: ... ProtoScript II reverse transcriptase (NEB; Cat#B0368) was used to generate cDNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5μl of 10x BstPol II buffer (NEB), 1.5μl of 10mM dNTPs ...
-
bioRxiv - Microbiology 2022Quote: ... the NEB Ultra II FS kit (NEB #E6177L ...
-
bioRxiv - Cancer Biology 2022Quote: ... PCR-amplified (NEBNext Ultra II Q5; NEB) using primers DCF01 5’-CTTGTGGAAAGGACGAAACACCG-3’ and DCR03 5’-CCTAGGAACAGCGGTTTAAAAAAGC-3’ and subjected to single-end 75 bp (SE75 ...
-
TIR signaling promotes the interactions between EDS1/PAD4 and ADR1-L1 and oligomerization of ADR1-L1bioRxiv - Plant Biology 2021Quote: ... ProtoScript II reverse transcriptase (NEB; Cat#B0368) was used to generate cDNA ...
-
bioRxiv - Neuroscience 2020Quote: Illumina compatible libraries were made from Visium derived cDNA using a modified protocol derived from NEB Ultra II DNA FS kit (NEB #E6177). Visium derived spatial cDNA was diluted to 100ng in 26μl and combined with 7μl NEBNext Ultra II FS Reaction Buffer and 2μl NEBNext Ultra II FS Enzyme Mix and incubated at 37°C for 15min ...
-
bioRxiv - Cell Biology 2020Quote: ... 0.4 μl USER II (New England Biolabs) enzyme mix was added an the suspension incubated for 45 min at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... Protoscript II Reverse Transcriptase (New England Biolabs) was used to make cDNA PCR templates from parasite RNA (Toxoplasma GT1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... (ThermoFisher Scientific SuperScript II, NEB random nonamers). The samples were purified with Ampure XP beads to isolate the cDNA and samples were eluted to 30µl ...
-
bioRxiv - Immunology 2022Quote: ... NEB Next Ultra II Q5 polymerase (NEB) was used for 10 cycles to append P5 and P7 Illumina sequencing adaptors ...
-
bioRxiv - Biochemistry 2023Quote: ... EcoRI and AseI in buffer II (NEB) and the insert was subcloned into pUC18 ...
-
bioRxiv - Microbiology 2024Quote: ... the NEBNext ultra II ligation module (NEB). After ligation ...
-
bioRxiv - Microbiology 2023Quote: ... MARCH2 chimeras containing the TM domains from either human MARCH4 or human transferrin receptor (TR) were generated using the NEBuilder HiFi DNA assembly kit (New England Biolabs) and the primers listed in Supplemental Table S2 ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was synthesized from 0.5-1 µg of RNA per sample using Protoscript II RT and Random Primer Mix (New England Biolabs). qPCR reactions were performed on cDNA using iQ SYBR Green supermix (BioRad) ...
-
bioRxiv - Neuroscience 2022Quote: ... cDNA was synthesized from 1 μg total RNA using the ProtoScript® II First Strand cDNA Synthesis Kit (NEB) with oligo-dT priming according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... the plug was incubated in 160 μl of 1× NEBuffer 3.1 buffer containing 160 units of Bgl II (New England BIolabs) overnight at 37°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 μg of total RNA was used in cDNA synthesis using ProtoScript II Reverse Transcription kit (NEB, Cat # e6560) as per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 μg of immunopurified GST-tagged WRN fragment was phosphorylated in vitro by Casein Kinase II (New England Biolabs) in the presence of 1X NEBuffer (50mM Tris-HCl ...
-
bioRxiv - Cell Biology 2024Quote: ... approximately 1 μg of gDNA each sample was subject to bisulfite conversion for shotgun library construction (NEB Ultra II) and Illumina HiSeqX PE150 sequencing ...
-
bioRxiv - Plant Biology 2024Quote: ... cDNA was synthesized from 1 µg total RNA using the ProtoScript® II First Strand cDNA Synthesis Kit (NEB) with d(T)23VN primer.
-
bioRxiv - Molecular Biology 2023Quote: ... each plug was incubated in 160 μl of 1x NEBuffer 3.1 containing 1 unit/μl of Bgl II (New England Biolabs) overnight at 37°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... the plug was incubated in 160 μL of 1× NEBuffer 3.1 buffer containing 160 units of Bgl II (New England Biolabs) overnight at 37°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... the plug was incubated in 160 μL of 1× NEBuffer 3.1 buffer containing 160 units of Bgl II (New England Biolabs) overnight at 37°C ...
-
bioRxiv - Genomics 2019Quote: ... 3.5μL of Ultra II End-prep reaction buffer and 3μL of Ultra II End-prep enzyme mix (all from New England Biolabs); the mixture was incubated at 20°C for 15 minutes and 65°C for 15 minutes ...
-
bioRxiv - Genomics 2020Quote: ... 0.5 μL of Ultra II Ligation Module Enhancer and 10 μL of Ultra II Ligation Module master mix (NEB) made up of a total of 20 μL with NFW ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 1 μl anti-MBP Monoclonal Antibody (New England Biolabs, #E8032L) and 6 μl anti-E ...
-
bioRxiv - Cancer Biology 2021Quote: ... samples were mixed with 7 μl 5x Ultra II FS buffer and 2 μl Ultra II FS enzyme (New England BioLabs), and incubated 12 minutes at 37 °C followed by 30 minutes at 65 °C ...
-
bioRxiv - Immunology 2021Quote: ... ii) fragmentation and adapter ligation (NEBNext® UltraTM II FS DNA Library Prep Kit for Illumina, NEB, cat. no. E7805S), and iii ...
-
bioRxiv - Molecular Biology 2022Quote: ... purified DNA fragments were subjected to library preparation with NEB Next Ultra II and NEB Multiplex Oligo Set I/II as per manufacturer (New England Biolabs) protocol without size selection ...
-
bioRxiv - Plant Biology 2020Quote: ... and cDNA was synthesized from 1 µg of total RNA using ProtoScriptR II Reverse Transcriptase (New England BioLabs, MA, USA) in 20 µl reaction with oligo (dT ...