Labshake search
Citations for New England Biolabs :
101 - 150 of 244 citations for Strat M Membrane Transdermal Diffusion Test Model since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... and cDNA was synthesized using M-MuLV reverse transcriptase enzyme (New England Biolabs #M0253S) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... for 3 hours at 55°C and M-2 was digested with XhoI (NEB) overnight at 37°C ...
-
bioRxiv - Microbiology 2022Quote: 1.5 μg of RNA was reverse transcribed using M-MuLV Reverse Transcriptase (NEB M0253L) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... 2 µL of 0.1 M Dithiothreitol (cat. n° M0368L, NEB, New England Biolabs, USA), 1 µL of 10 mM dNTP (cat ...
-
bioRxiv - Immunology 2021Quote: ... 2 µL of 0.1 M Dithiothreitol (cat. n° M0368L, NEB, New England Biolabs, USA), 1 µL of 10 mM dNTP (cat ...
-
bioRxiv - Plant Biology 2021Quote: ... First-strand cDNA was synthesized using oligo(dT) and M-MuLV reverse transcriptase (NEB). Real-time qPCR was performed using PowerUp™ SYBR™ master mix (Applied Biosystems ...
-
bioRxiv - Immunology 2021Quote: ... then 1µl M-MLV reverse transcriptase enzyme was (New England BioLabs, Catalogue no.-M0368) added to each sample ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA was synthesized with M-MuLV Reverse Transcriptase (200 U/μL, New England Biolabs). Real-time PCR was performed by a CFX-96 real-time system (Bio-Rad ...
-
bioRxiv - Cancer Biology 2024Quote: ... Equal amounts of RNA were transcribed with reverse-transcription (M-MuLV Reverse Transcriptase, NEB). Quantitative real-time PCR (qRT-PCR ...
-
bioRxiv - Cell Biology 2023Quote: ... and converted to cDNA using random primers and M-MuLV RT-PCR enzyme (NEB). Proinsulin-specific primers (GTGAACCAGCACCTGTGC Fw and CGGGTCTTGGGTGTGTAGAAG Rv ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 μM of dsDNA was incubated with CpG methyltransferase (M. SssI, New England Biolabs) in the presence of 200 μM of S-adenosylmethionine ...
-
bioRxiv - Neuroscience 2020Quote: ... RNA was reverse-transcribed to cDNA using M-MuLV Reverse Transcriptase kit (NEB, Ipswich, MA) and cDNA was analyzed with QPCR.
-
bioRxiv - Cancer Biology 2021Quote: ... we synthesized complementary DNA (cDNA) using a mixture of M-MuLV reverse transcriptase (NEB, M0253L), RNAse inhibitor (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... and 1 μL of 200 U M-MuLV reverse transcriptase enzyme (B0253S, New England Biolabs). Negative controls were reactions without the RT enzyme and without sample ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was reverse-transcribed from RNA using random hexamers and M-MuLV reverse transcriptase (NEB). Primer sequences for qPCR were designed using Primer3 such that primers are located in different exons or in exon-exon junctions and checked for any off-targets using the NCBI Primer-BLAST tool ...
-
bioRxiv - Molecular Biology 2022Quote: ... Complementary DNA was synthesised with the M-MuLV Reverse Transcriptase (New England Biolabs, Frankfurt, Germany) and used as a template for quantitative Real-Time PCR (qRT-PCR ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 25 U of M-MuLV Reverse Transcriptase with corresponding buffer (M0253, New England Biolabs) was added and the reaction was incubated at 42 °C for 1 h ...
-
bioRxiv - Cell Biology 2024Quote: ... RNA was reverse transcribed with Moloney murine leukemia virus (M-MuLV) transcriptase (New England Biolabs). The purity and concentration of RNA were measured using NanoDrop 2000 Spectrophotometer (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The cDNA was synthesized from 1 μg of RNA using M-MuLV Reverse Transcriptase (NEB) and random hexamer primer (Promega) ...
-
bioRxiv - Cell Biology 2023Quote: ... and M-MuLV reverse transcriptase enzyme (200,000 U mL−1, New England Biolabs, Ispwich, USA) was added per sample ...
-
bioRxiv - Developmental Biology 2023Quote: ... RNAse inhibitor (M0314L, New England Biolabs, and M-MuLV reverse transcriptase (M0253L, New England Biolabs). RT-qPCR was performed using Power SYBR Green PCR Master Mix (4368708 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 2ug RNA was reverse-transcribed using M-MuLV reverse transcriptase enzyme (New England Biolabs #M0253S) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... cDNA synthesis was carried out with M-MuLV Reverse Transcriptase (New England Biolabs, #Cat no: M0253L), and qPCR reactions were conducted using gene-specific primers with SensiFAST SYBR No-ROX kit (Bioline ...
-
bioRxiv - Microbiology 2022Quote: ... 2 mM 3’-O-Me-m 7G(5’)ppp(5’)G cap structure analog (NEB S1411S), 0.5 mM GTP ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.8 M guanidine HCl) containing 8 units/ml and Proteinase K (P8107S, New England Biolabs Inc.) was added freshly to the digestion buffer ...
-
bioRxiv - Genomics 2021Quote: DNaseI-treated RNA was reverse transcribed using M-MuLV reverse transcriptase (New England Biolabs, Ipswich, Massachusetts) and random hexamer primers ...
-
bioRxiv - Developmental Biology 2022Quote: ... It was subsequently reverse transcribed into cDNA with M-MuLV reverse transcriptase (New England Biolabs M0253S). qRT-PCR was carried out using SYBR Green PCR Master Mix (Applied Biosystems 4368708 ...
-
bioRxiv - Plant Biology 2022Quote: Reverse transcription was performed using 2 µg of total RNA and M-MuLV Reverse Transcriptase (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... cDNA synthesis was performed using ProtoScript M-MuLV First Strand cDNA synthesis kit (New England Biolabs) and random hexamer primers ...
-
bioRxiv - Microbiology 2023Quote: ... cDNA of the samples was made following the NEB M-MuLV Reverse Transcriptase protocol (NEB #M0253). Qubit was used to assess the concentration of cDNA in the samples ...
-
bioRxiv - Cell Biology 2023Quote: ... The DNA was then digested using Dpn II (375 U DpnII (NEB, R0543 T/M/L) in 1× Dpn II buffer (NEB ...
-
bioRxiv - Biophysics 2023Quote: ... A total of 1 μg of cDNA was prepared using the M-MulV reverse transcriptase (NEB) as per vendor instructions ...
-
bioRxiv - Microbiology 2024Quote: ... 2 µl 1 M DTT and 5 µl T4 polynucleotide kinase (NEB, 10 U/µl, #M0201) and incubated at 37 °C for 2 h ...
-
bioRxiv - Biochemistry 2024Quote: ... The resulting material was reverse transcribed (M-MLV RT) and purified (NEB Monarch DNA Cleanup Kit). Two rounds of PCR were used to tag each reaction with sequencing barcodes (Illumina ...
-
bioRxiv - Immunology 2024Quote: ... RNA was purified with silica membrane spin columns (NEB, T2050) and quantified by NanoDrop ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 1 µg RNA was used for each reverse transcriptase reaction using M-MuLV Reverse Transcriptase (NEB) according to manufacturer protocol ...
-
bioRxiv - Biochemistry 2020Quote: ... Approximately 200 ng/μl of RNA was used for cDNA synthesis by M-MuLV reverse transcriptase (NEB) and 3′ oligo-dT primer ...
-
bioRxiv - Microbiology 2020Quote: ... The reverse transcription reaction (20 μL) contained 2 μL 10x M-MulV buffer (B0253S, New England Biolabs), 1 μL of 50 μM Oligo 18 dT (SO132 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 0.25 μL of reverse transcriptase (M-MuLV Reverse Transcriptase kit from New England Biolabs, CAT# M0253S) was prepared and 3.25 μL of this master mix was added to each of the samples for a total volume of 20 μL ...
-
bioRxiv - Genomics 2021Quote: ... 4 μg of total RNA were reverse-transcribed by the M-MLV reverse transcriptase (New England BioLabs) following the manufacturer specifications and using oligo d(T ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 µl freshly made 1 M NH4HCO3 and calf intestinal alkaline phosphatase (1 U, New England Biolabs) were added ...
-
bioRxiv - Biochemistry 2023Quote: ... M Y229A and MT205D substitutions were generated using the Quick change directed mutagenesis kit (New England Biolabs), as recommended by the manufacturer.
-
bioRxiv - Microbiology 2023Quote: ... cDNA was synthesized from extracted RNA samples using M-MuLV reverse transcriptase kit (New England Biolabs Ltd) based on the manufacturer’s instructions and using customized primers splice leader (SL_F ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.8 M guanidine HCl) containing 8 units mL−1 of Proteinase K (P8107S, New England Biolabs Inc.). Gels were digested at room temperature overnight ...
-
bioRxiv - Cell Biology 2024Quote: ... Embryos were injected with 1 mg of gRNA and 5 μ M of Cas9 protein (NEB, 10128356) at 1-cell stage ...
-
bioRxiv - Genetics 2021Quote: ... 1 μg of RNA was reverse transcribed in cDNA using random hexamers and M-MuLV reverse transcriptase (NEB). qPCRs were assembled with Absolute QPCR ROX Mix (Thermo Scientific ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... was generated from pCG1-SARS-2-S (a kind gift from M. Hoffmann9 by PCR (Phusion polymerase (NEB)) using primer pairs ...
-
bioRxiv - Genomics 2021Quote: ... The RNA samples were reverse transcribed using random hexamer primers and M-MuLV Reverse Transcriptase (New England Biolabs) and the resulting cDNA subjected to qPCR ...
-
bioRxiv - Genetics 2023Quote: ... 1.2 M sorbitol) and resuspended in digestion buffer (Buffer B, 200 mM Vanadyl ribonucleoside complex [VRC from NEB] ...
-
bioRxiv - Bioengineering 2023Quote: ... The RT-RPA was performed at 42°C for 30 min by combining M-MuLV-RT (NEB #M0253L) with TwistAmp Basic (TwistDx #TABAS03KIT) ...