Labshake search
Citations for New England Biolabs :
101 - 150 of 10000+ citations for Prostaglandin E2 PGE2 Multi Format ELISA Kit 5 Strip Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... poly(A) RNA (2-5 ng) was converted to cDNA using the Protoscript II kit (New England Biolabs) and a supplied mix of random hexamer and d(T)23VN primers ...
-
bioRxiv - Molecular Biology 2022Quote: ... 50 uL of Quick Ligation Buffer and 5 uL of Quick T4 Ligase (NEB Quick Ligation Kit, M2200S). The ligation reaction was incubated for 10 minutes at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: 9N_VRA3 adapter oligonucleotide (Supplementary Table 1) was pre-adenylated with the 5’ DNA Adenylation Kit (New England Biolabs) according to the manufacturer’s protocol at a 5X scale ...
-
bioRxiv - Molecular Biology 2023Quote: ... The RNA adaptor provided by the kit was phosphorylated on its 5’ end using T4 Polynucleotide Kinase (NEB). RNA (1 μg ...
-
bioRxiv - Molecular Biology 2023Quote: ... three 25 μl PCR reactions were pooled and purified using Monarch PCR & DNA Cleanup Kit (5 μg; NEB), according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... and G(5′)ppp(5′)A RNA (GpppA) (NEB, # S1406S) and G(5′)ppp(5′)G RNA (GpppG ...
-
bioRxiv - Genetics 2020Quote: ... and 5 μl T4 PNK (NEB M0201, 5 U/μl), and incubated for 30 min at room temperature ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 units of Klenow Fragment (3’à 5’ exo-, NEB), CutSmart buffer (NEB) ...
-
bioRxiv - Genomics 2020Quote: ... 5′ de-capping with RNA 5′ pyrophosphohydrolase (RppH, NEB, M0356S), (3 ...
-
bioRxiv - Biochemistry 2020Quote: ... and G(5′)ppp(5′)G RNA (GpppG) (NEB, # S1407S) are from New England Biolabs (NEB) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5’-cap was removed using RNA 5′ pyrophosphohydrolase (Rpph, NEB) followed by addition of a phosphate group to the 5’ end using T4 polynucleotide kinase (T4 PNK ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 µl of Klenow Fragment (3′→5′ exo-, NEB, M0212S), 3 µl of T4 polynucleotide kinase (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... with a 384 well plate using the NEB Luna Universal One-Step RT-qPCR kit (NEB #E3005L, New England Biolabs Inc) and a reaction volume of 10 μl with 2.5 μl of sample ...
-
bioRxiv - Microbiology 2020Quote: ... with a 384 well plate using the NEB Luna Universal One-Step RT-qPCR kit (NEB #E3005L, New England Biolabs Inc) and a reaction volume of 10 μl with 2.5 μl of sample ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 5′-cap was removed with RNA 5’ Pyrophosphohydrolase (Rpph, NEB), and the 5′-hydroxyl group was repaired with T4 polynucleotide kinase (BioLabs) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 µ l of Klenow Fragment (3’→5’ exo-, NEB, M0212S) 3µl of T4 Polynucleotide Kinase (NEB ...
-
bioRxiv - Genomics 2020Quote: RNA 5’ pyrophosphohydrolase (RppH; 5 U/µL) (NEB, cat. no. M0356S)
-
bioRxiv - Molecular Biology 2021Quote: ... the 5’-cap was removed with RNA 5’ pyrophosphohydrolase (Rpph, NEB), after which 5’end was repaired with T4 polynucleotide kinase (NEB) ...
-
bioRxiv - Genomics 2022Quote: ... 5 μl of 5mM dNTPs containing 5-methyl-dCTP (N0356S, NEB) instead of dCTP ...
-
bioRxiv - Genomics 2023Quote: ... 5 μL of Digestion-2 mix (NdeI (5 U, NEB, R0111L) and/or BglII (5 U ...
-
bioRxiv - Bioengineering 2022Quote: ... the 5S and Saba PCR products were purified using Monarch® PCR & DNA Cleanup Kit (5 μg) (NEB, # T1030). The purified DNA sequence was then analyzed through Sanger sequencing (GENEWIZ from Azenta ...
-
bioRxiv - Plant Biology 2023Quote: The m6A immunoprecipitation was performed from 5–day–old seedlings using the EpiMark® N6–Methyladenosine Enrichment kit (NEB) starting from 4 μg of total RNA ...
-
bioRxiv - Developmental Biology 2023Quote: ... was generated from full-length CSN-5 using a Q5 site-directed mutagenesis kit per manufacturer’s instructions (New England BioLabs). Truncated CSN-5 constructs were made by PCR from full-length CSN-5 and inserted into pGEX-KG plasmids ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 pmol of TP_MAAAPQKCAAA* mRNA (see “Toeprinting assays” section) and components of the PURExpress ΔRibosomes Kit (New England Biolabs). The reaction was incubated at 37ºC for 20 min and then diluted in 50 mM Hepes KOH pH 7.5 ...
-
bioRxiv - Immunology 2023Quote: ... Total RNA samples (5-500 ng) were hybridized with NEBNext rRNA Depletion Kit v2 (Cat# E7400; New England Biolabs) to diminish rRNA from the samples ...
-
bioRxiv - Genomics 2019Quote: 5’ repaired RNA was ligated to reverse 5’ RNA adaptor (5’-rCrCrUrUrGrGrCrArCrCrCrGrArGrArArUrUrCrCrA-3’) with T4 RNA ligase I (NEB) under manufacturer’s conditions for 2 h at 20°C ...
-
bioRxiv - Molecular Biology 2022Quote: For chitin-based sandwich ELISA 50 μl of chitin magnetic beads (New England Biolabs, Ipswich, MA, USA) were transferred into a 1.5 ml reaction tube ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 µg of total RNA was incubated with 5 μM oligo-(dT)-anchor (5’GCGAGCTCCGCGGCCGCGTTTTTTTTTTTT3’) and 5 U of Klenow polymerase (New England Biolabs) for 1 h at 37°C for template extension of the poly(A ...
-
bioRxiv - Systems Biology 2021Quote: ... the purified DNAs were annealed using random nonamer primers with a 5′-biotin tag (5′-Biotin-CTACACGACGCTCTTCCGATCTNNNNNNNNN-3′) in the presence of Klenow fragments (3′-5′ exo-, New England Biolabs). Then ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Cancer Biology 2022Quote: ... 5 µg DNA was digested with 5 µl RNase H (NEB, M0297), 3 µl Hind III (Fisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... m7G(5’)ppp(5’) A RNA Cap Structure Analog (New England Biolabs) was included in the transcription reaction ...
-
bioRxiv - Microbiology 2021Quote: ... T5 exonuclease diluted 1:5 with 5× reaction buffer (New England BioLabs) (0.01 units/μl) ...
-
bioRxiv - Genomics 2021Quote: ... (iii) 5′ de-capping with RNA 5′ pyrophosphohydrolase (NEB, Ipswich, MA; M0356), (iv ...
-
bioRxiv - Genomics 2022Quote: ... (iii) 5′ de-capping with RNA 5′ pyrophosphohydrolase (NEB, Ipswich, MA; M0356), (iv ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 5 µg of DNA were nicked with 5 units of Nb.BbvCI (NEB) in CutSmart buffer (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... Full-length 265 nt 5’ UTR of SARS-CoV-2 was subcloned to replace the 5’ UTR of human CMV in the pLV-mScarlet vector using a Hifi one-step kit (Gibson Assembly, NEB). Full-length ...
-
bioRxiv - Genetics 2021Quote: DNA libraries were prepared from 5 ng of total genomic DNA using the NEBNext Ultra II FS DNA Library kit for Illumina (New England Biolabs). All volumes specified in the manufacturer’s protocol were divided by four ...
-
bioRxiv - Molecular Biology 2021Quote: ... Full-length 265 nt 5′ UTR of SARS-CoV-2 was subcloned to replace the 5’ UTR of human CMV in the pLV-mScarlet vector using a Hifi one-step kit (Gibson Assembly, NEB). Full-length ...
-
bioRxiv - Genomics 2020Quote: PCR3 was performed by subtracting 2-3 cycles from the Ct and using 2.5 uL of a mix of distinct indexed primers from the NEBNext Dual Index Kit for Illumina (New England Biolabs) using 22.5 uL PCR2 product in a 50 uL reaction volume (Q5 UltraII mastermix with EvaGreen (Biotium) ...
-
bioRxiv - Microbiology 2019Quote: ... 5’ UTR reporter constructs were assembled using NEBuilder® HiFi DNA Assembly Cloning Kit (#E5520S New England Biolabs Ipswich, MA). All amplifications were carried out following the manufacturer’s guidelines ...
-
bioRxiv - Genomics 2020Quote: ... was transcribed from a sgRNA-coding PCR product with a 5′ T7 promoter sequence using HiScibe T7 Quick High yield RNA Synthesis kit (NEB). The transcription was performed at 37 °C overnight and then purified by phenol ...
-
bioRxiv - Genetics 2020Quote: ... ChIP enrichment was determined by RT-qPCR (Supplementary Table 5) prior to addition of sequencing adaptors using NEBNext Ultra II DNA Library Prep kit for Illumina (New England Biolabs). ATAC-seq was performed as previously described76 ...
-
BRD2 inhibition blocks SARS-CoV-2 infection by reducing transcription of the host cell receptor ACE2bioRxiv - Cell Biology 2021Quote: ... 5′-TAATCAGACAAGGAACTGATTA-3′ (Forward) and 5′-CGAAGGTGTGACTTCCATG-3′ (Reverse) were used with the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) in an Applied Biosystems QuantStudio 6 thermocycler or an Applied Biosystems StepOnePlus system ...
-
bioRxiv - Biochemistry 2021Quote: ... 5’-TAATCAGACAAGGAACTGATTA-3’ (Forward) and 5’-CGAAGGTGTGACTTCCATG-3’ (Reverse) were used with the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) in an Applied Biosystems QuantStudio 6 thermocycler ...
-
Lessons from the meiotic recombination landscape of the ZMM deficient budding yeast Lachancea waltiibioRxiv - Genetics 2021Quote: ... DNA libraries were prepared from 5 ng of total genomic DNA using the NEBNext Ultra II FS DNA Library kit for Illumina (New England Biolabs). All volumes specified in the manufacturer’s protocol were divided by four ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA synthesis was performed for 60 min at 42 °C and 5 min at 80 °C using ProtoScript II First Strand cDNA synthesis kit (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... transcripts containing artificial 5’ UTRs were performed using PCR-amplified templates and the HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: We assembled mutant libraries by combining the linearized sensor backbone with each oligo subpool at a molar ratio of 1:5 using Golden Gate Assembly Kit (New England Biolabs; 37 °C for 5 min and 60 °C for 5 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... was generated by the assembly of 5 DNA fragments using the NEBuilder HiFi DNA assembly cloning kit (New England Biolabs). These DNA fragments ...