Labshake search
Citations for New England Biolabs :
101 - 150 of 240 citations for Phospho p53 S392 Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... after which 2 µL of Recombinant PNGaseF (Glycerol-free) (New England Biolabs, Ipswich, MA; catalog # P0709L) was added to each sample ...
-
bioRxiv - Molecular Biology 2019Quote: ... These fragments were dephosphorylated with 30 units of recombinant shrimp alkaline phosphatase (M0371, NEW ENGLAND BIOLABS) for 1 hour at 37 °C with RNasin Plus (N2611 ...
-
bioRxiv - Microbiology 2019Quote: ... 10% cRBCs in PBS were pre-treated with recombinant neuraminidase from Clostridium perfringens (New England Biolabs) for 1.5 hour at 37°C ...
-
bioRxiv - Microbiology 2022Quote: All recombinant proteins were expressed in Escherichia coli T7 Express lysY/Iq cells (New England Biolabs). Except for GST-PP1γ ...
-
bioRxiv - Neuroscience 2023Quote: ... recombinant SYNJ2BP (0.5 µg) was dephosphorylated using 1 µl of calf intestinal alkaline phosphatase (CIP) (NEB) in 1x CutSmart Buffer in a total volume of 10 µl ...
-
bioRxiv - Molecular Biology 2023Quote: ... the enzymatic activity of the commerically availablale recombinant vaccinia virus methyltransferase mRNA 2’O-methyltransferase (NEB), abbreviated hereagter as VMTR1 ...
-
bioRxiv - Microbiology 2022Quote: ... EE62/63AA and the 2_87 double serine phospho-mimetic SE53/57EE or “SS-EE”) using Phusion-II polymerase (New England Biolabs) and standard protocols ...
-
bioRxiv - Molecular Biology 2019Quote: ... All the pCMV and pcDNA3.1-myc-eIF6 phospho-site mutants were generated using the Q5® Site-Directed Mutagenesis Kit (New England Biolabs) using the forward and reverse primers listed in Appendix Table S1 ...
-
bioRxiv - Cell Biology 2023Quote: ... and GST-Elm1-R (GATGCGGCCGCTCGAGCTATATTTGACCATTATCTGCAAAG) to amplify each Elm1 phospho-mutant and cloned into pGEX-4T1 using BamHI and XhoI (New England Biolabs). All plasmid constructs and mutagenesis were confirmed correct via sequencing at the DNA Sequencing Facility ...
-
bioRxiv - Genetics 2021Quote: ... on DNA were performed in the buffer supplied with the commercial recombinant enzyme (New England Biolabs (NEB) dam Methyltransferase Reaction Buffer or CutSmart Buffer ...
-
bioRxiv - Genetics 2021Quote: ... on DNA were performed in the buffer supplied with the commercial recombinant enzyme (New England Biolabs (NEB) dam Methyltransferase Reaction Buffer or CutSmart Buffer ...
-
bioRxiv - Cell Biology 2022Quote: Recombinant condensin II holo(WT) at 500 nM was mixed with or without λ protein phosphatase (NEB) at a final concentration of 400 U/µL in 1x NEBuffer for Protein MetalloPhosphatases supplemented with 1 mM MnCl2 and incubated at 30°C for 60 min ...
-
bioRxiv - Immunology 2020Quote: ... The amplified DNA was then treated with recombinant Shrimp Alkaline Phosphatase and Exonuclease 1 (New England Biolabs), and sent to ELIM Biopharm for sequencing ...
-
bioRxiv - Cell Biology 2023Quote: cDNA encoding recombinant MUC17(7TR) with N-terminal 3xFlag tag was generated using Gibson Assembly (E2611S, NEB) following the manufactures protocol ...
-
bioRxiv - Plant Biology 2023Quote: ... and recombinant MBP-tagged proteins purification were performed according to the manufacturer’s instructions of Amylose Resin (NEB).
-
bioRxiv - Cell Biology 2023Quote: ... 0.5 µg of purified recombinant WRN protein was treated with Lambda Protein Phosphatase (LPP, New England Biolabs) in 1X PMP buffer (50 mM HEPES pH 7.5 ...
-
bioRxiv - Neuroscience 2023Quote: ... Recombinant nanobody-displaying phages were rescued with 2×1011 PFU of M13KO7 Helper phage (New England Biolabs). Rescued phages were suspended in 1 ml of phosphate buffered saline (PBS ...
-
bioRxiv - Neuroscience 2024Quote: ... purified ∼25−50-nt RNA fragments underwent treatment with recombinant shrimp alkaline phosphatase (New England Biolabs; M0371) to remove 5’-and 3’-phosphates ...
-
bioRxiv - Genetics 2024Quote: ... Anti-rabbit (#7074, NEB) and anti-mouse (#7076 ...
-
bioRxiv - Developmental Biology 2020Quote: ... 2014) by incubating 0.25 μl of plasmid with 1 μl of recombinant Cre recombinase (New England Biolabs M0298S) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: Each peptide was tested for its ability to be cleaved by recombinant furin (10 U/mL; NEB; P8077) in a buffer of 100 mM HEPES ...
-
bioRxiv - Biochemistry 2022Quote: ... purified RML or ME7 fibrils were prepared as above and digested using recombinant PNGase F (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... The recombinant fusion proteins were purified via affinity chromatography from bacterial extracts using amylose resin (New England Biolabs) according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... EcoRI sites underlined) and different concentration of recombinant His-SET8 protein (0 to 1.4 μM, New England Biolabs) were incubated for 10 min on ice in 1× GRB binding buffer [20 mM HEPES pH 7.5 ...
-
bioRxiv - Molecular Biology 2022Quote: The recombinant pET6xHN-N constructs were transformed into Escherichia coli strain BL21(DE3) (New England Biolabs, MA, USA). The transformed clones were cultured at 37 °C in LB medium with 100 μg/mL Carbenicillin and were induced by adding 1 mM isopropyl β-D-1-thiogalactopyranoside (IPTG ...
-
bioRxiv - Molecular Biology 2023Quote: NSD1/2 WT and different cancer mutants (3.4 μM) were mixed with recombinant H3.1 protein (1 μg) (purchased from NEB) or recombinant H3.1 mononucleosomes in methylation buffer (50 mM Tris/HCl ...
-
bioRxiv - Neuroscience 2023Quote: Specificity of anti-H3K9Me3 was tested against two types of substrates: recombinant histone H3 (New England BioLabs, M2507S), which lacked methylation ...
-
bioRxiv - Cell Biology 2023Quote: ... Purified sgRNAs targeting tlnrd1 and slc45a2 were pooled separately and complexed with recombinant Cas9 protein (New England Biolabs) in vitro using 300mM KCl buffer for 5 minutes at +37°C ...
-
bioRxiv - Microbiology 2023Quote: ... Each peptide was tested for its ability to be cleaved by recombinant furin (10 U/mL; NEB; P8077) in a buffer of 100 mM HEPES ...
-
bioRxiv - Molecular Biology 2022Quote: ... rabbit anti-DYKDDDDK (#D6W5B; NEB) and rabbit anti-myc (#71D10 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... rabbit anti-SNAP-tag (NEB; P9310 ...
-
bioRxiv - Molecular Biology 2019Quote: ... After annealing the complex an equimolar amount was mixed with 1000ng Cas9 recombinant protein (NEB; final conc 20ng/ul) and incubated at RT for 15’ ...
-
bioRxiv - Cell Biology 2022Quote: Recombinant C-terminally FLAG-Tagged TEX264 was produced by PURExpress in vitro protein synthesis kit (E6800; New England Biolabs). Phosphorylation reaction containing TEX264-FLAG and CK2 (mixture of CK2A1 and CK2B ...
-
bioRxiv - Genetics 2019Quote: P2C-Cas9 and P2C-EGFP proteins were expressed from pET28a-P2C-Cas9 and pRSET-P2C-EGFP respectively by recombinant BL21 E.coli (NEB) as described in detail in Chaverra-Rodriguez et al ...
-
bioRxiv - Biochemistry 2020Quote: ... 20 μg each of the recombinant proteins were lyophilized and digested with PNGase F (P0701S, New England Biolabs Inc.) according to the manufacture’s instruction ...
-
bioRxiv - Microbiology 2021Quote: ... were used to amplify the pQE60- ompA recombinant plasmid (Size- 4.5 kb) using Phusion high fidelity DNA polymerase (NEB). The reaction mixture was heated at 950C for 10 minutes for the plasmid’s denaturation ...
-
bioRxiv - Microbiology 2021Quote: ... 40 μL purified supernatant were combined with 2,500 units recombinant glycerol-free PNGase F and Glycobuffer 2 (New England Biolabs) following the manufacturer’s protocol for non-denaturing digestion and incubated at 37°C for 5 hours ...
-
bioRxiv - Genetics 2022Quote: ... Eggs were then injected under air-dry conditions with a solution containing 300ng/μl of recombinant Cas9 Nuclease (NEB) and 100ng/ul each of four sgRNAs targeting the first exon of the Oatp74D gene (S2 Table) ...
-
bioRxiv - Microbiology 2023Quote: ... Enzymatic deglycosylation was performed on denatured PrPres with 1,000 U of recombinant PNGase (peptide N-glycosidase F; New England Biolabs) for 2h at 37°C in 1% Nonidet P40 and the manufacturer’s buffer.
-
bioRxiv - Microbiology 2022Quote: ... Recombinant plasmids encoding a catalytically inactive 3Dpol (3Dneg) were generated using the Q5 Site-Directed Mutagenesis Kit (NEB, E0554S). Nucleotides at position 6891 and 6892 of the CVB3/28 genome were mutated from AT to GC ...
-
bioRxiv - Developmental Biology 2023Quote: ... cells were pelleted at 500 x g for 5 minutes and resuspended in 8µg/mL recombinant albumin (New England Biolabs) in dPBS-/- ...
-
bioRxiv - Cell Biology 2023Quote: ... for 1 h at room temperature before being incubated with 1.0 µg/mL of recombinant human histone H3.1 (New England Biolabs, #M2503S) for 1 h at room temperature ...
-
bioRxiv - Immunology 2020Quote: ... was inserted into a published oligonucleotide scaffold (Talbot and Amacher, 2014) and injected together with recombinant Cas9 protein (New England Biolabs) into 1-2 cell stage zebrafish (AB strain) ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... were coated to dry overnight at 37°C with 400 ng/well of recombinant His-tagged GT198 proteins together with 5 μg/well of purified BSA (NEB) in a volume of 50 μl ...
-
bioRxiv - Cancer Biology 2019Quote: ... were coated to dry overnight at 37°C with 400 ng/well of recombinant His-tagged GT198 proteins together with 5 µg/well of purified BSA (NEB) in a volume of 50 µl ...
-
bioRxiv - Microbiology 2020Quote: Template DNA was amplified by PCR using custom DNA primers (Table S3) and recombinant Phusion Hot Start polymerase (New England Biolabs). In vitro transcription was carried out in a volume of 2.5 mL comprising 1.0 mL of PCR reaction as template ...
-
bioRxiv - Genomics 2021Quote: 1 µg of genomic DNA (nuclear + mitochondrial DNA) per 50 µl reactions was digested with 40 units of the recombinant restriction enzyme BamHI-HF (NEB) for 1 hour at 37°C in the presence of CutSmart buffer (NEB) ...
-
bioRxiv - Cell Biology 2022Quote: ... All the point mutations in the recombinant LC3B and GABARAP were generated by Q5 Site-Directed Mutagenesis Kit (New England BioLabs). pGEX-6P1-GST-ATG3 was a gift from Dr ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... coli C2523 pMAL-c5X vector and recombinant MUP (rMUP) was made using pMAL Protein Fusion and Purification System (New England Biolabs) using methods similar to prior studies27,36 ...
-
bioRxiv - Molecular Biology 2019Quote: 100µM of the synthesized phosphopeptides (Aapptec) or non-phosphorylated peptides were incubated with 350units of recombinant GSK3β (New England Biolabs) and cold kinase buffer ...