Labshake search
Citations for New England Biolabs :
101 - 150 of 426 citations for Phosphatidylinositol N acetylglucosaminyltransferase subunit Q PIGQ Antibody HRP since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... The N-terminal deletions were made using the HiFi DNA cloning kit from NEB to excise portions of the N-terminus of the gene ...
-
bioRxiv - Microbiology 2021Quote: ... removal of N-glycans was performed by digestion with PNGaseF (New England Biolabs, P0704S), according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... Deglycosylation was performed with peptide-N-glycosidase F (PNGase F; New England Biolabs, USA) following the manufacturer’s instructions [28] ...
-
bioRxiv - Cell Biology 2022Quote: ... and ligated into pcDNA5/FRT/TO-N-FLAG-BirA* using Quick Ligation Kit (NEB). Top10 competent E ...
-
bioRxiv - Microbiology 2024Quote: ... the product was incubated with 1 μL of dTTP (1 mM, NEB Catalog # N)443S) ...
-
bioRxiv - Microbiology 2024Quote: ... The SARS-CoV-2 Spike coding region was then amplified using Q Hot Start High-Fidelity DNA Polymerase (New England Biolabs) with forward (5’ TCATCGATGCATGGTACGCCACCATGTTTGTTTTTCTTGTTTTATTG 3’ ...
-
bioRxiv - Microbiology 2024Quote: ... Resulting cDNA was next used as input for a quantitative (q)PCR reaction using Luna Universal qPCR Master Mix (New England Biolabs). Cycling conditions were as follows ...
-
bioRxiv - Biochemistry 2020Quote: N-linked glycans were released from gp140 in-gel using PNGase F (New England Biolabs). The released glycans were subsequently fluorescently labelled with procainamide using 110mg/ml procainamide and 60mg/ml sodium cyanoborohydride ...
-
bioRxiv - Biochemistry 2020Quote: Tsetse salivary proteins were treated with peptide-N-glycosidase F (PNGase F, New England Biolabs), which cleaves all N-linked glycans except those with an α-1,3 fucose modification of the chitobiose core [20] ...
-
bioRxiv - Cell Biology 2021Quote: ... and pGEX6P1-N-HA were transformed into BL21(DE3) competent cells (New England Biolabs, C2527H) and grown overnight at 37°C in a starter culture ...
-
bioRxiv - Cell Biology 2021Quote: The presence of N-linked oligosaccharides was examined using PNGase F (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Cell Biology 2021Quote: The presence of N-linked oligosaccharides was examined using PNGase F (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Immunology 2021Quote: ... using the high-fidelity Master mix Q5 (cat. n° M0492S, NEB, New England Biolabs, USA), and the primers NDV-3LS1-2020-F1 (5’-GATCATGTCACGCCCAATGC-3’ ...
-
bioRxiv - Immunology 2021Quote: ... using the high-fidelity Master mix Q5 (cat. n° M0492S, NEB, New England Biolabs, USA), and the primers NDV-3LS1-2020-F1 (5’-GATCATGTCACGCCCAATGC-3’ ...
-
bioRxiv - Immunology 2020Quote: ... N-linked glycans were released from gp140 in-gel using PNGase F (New England Biolabs). The released glycans were subsequently fluorescently labelled with procainamide and excess label and PNGase F was removed using Spe-ed Amide-2 cartridges (Applied Separations) ...
-
bioRxiv - Molecular Biology 2021Quote: ... digested genomic DNA by O/N incubation at 16°C with T4 DNA ligase (NEB). Subsequently ...
-
bioRxiv - Biophysics 2024Quote: ... N-glycosylation was removed by a 1-hour incubation with PNGase F (500 U, NEB) and following digest with sequence-grade trypsin (Promega ...
-
bioRxiv - Synthetic Biology 2024Quote: A total of 400 U of exo-α-N-acetylgalactosaminidase (New England Biolabs, Cat # P0734S) was added to a solution of GalNAc5GlcNAc-hinge-Fc dimer (200 µg ...
-
bioRxiv - Microbiology 2024Quote: ... N-glycans were released from purified cwMPs through PNGase F treatment (New England Biolabs, UK), followed by purification using a Carbograph Extract-Clean column ...
-
bioRxiv - Molecular Biology 2023Quote: ... The plugs were washed in 20 ml of Milli-Q water for 30 minutes and then 10 ml of 1x rCutSmart buffer (New England Biolabs, B6004S) for 1 hour followed by a further hour in 5 ml of 1x rCutSmart buffer ...
-
bioRxiv - Biochemistry 2024Quote: ... Precipitated RNAs were resuspended in Milli-Q water and labeled at the 5’-end with [γ-32P]-ATP using T4 polynucleotide kinase (New England Biolabs). Excess [γ-32P]-ATP was removed by G-25 MicroSpin column (Cytiva ...
-
bioRxiv - Neuroscience 2024Quote: ... 5’UTR - GluA1flip(R) - 3’UTR and GluA3 flip(Q) (Y454A/R461G) was obtained using the Q5® Site-Directed Mutagenesis Kit (NEB). To obtain Halo-tag - GluA2flip(Q ...
-
Cancer-associated fibroblasts produce matrix-bound vesicles that influence endothelial cell functionbioRxiv - Cancer Biology 2023Quote: ... The membrane was incubated with HRP-conjugated (1/2,500 New England Biolabs, Ipswich, MA) or IRDye® (1/10,000 LI-COR Biosciences ...
-
bioRxiv - Molecular Biology 2021Quote: ... together with an N-terminal FLAG-emGFP-tag via NheI and NotI (both New England Biolabs) restriction sites ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5’ adaptor (rGrUrUrCrArGrArGrUrUrCrUrArCrArGrUrCrCr-GrArCrGrArUrCrNrNrNrCrGrArNrNrNrUrArCrNrNrN, N is for a random nucleotide) by T4 ligase 1(NEB) sequentially ...
-
bioRxiv - Microbiology 2021Quote: ... Plasmids from O/N cultures were extracted with the Monarch Plasmid Miniprep Kit (New England Biolabs) and sent for sequencing to LGC genomics.
-
bioRxiv - Biophysics 2022Quote: ... The human μOR and V2R were amplified with a SNAP tag at their N-terminal (NEB) and subcloned in the pcDNA4/TO plasmid (Invitrogen) ...
-
bioRxiv - Immunology 2021Quote: ... 2 µL of random primer mix 60 µM (cat. n° S1330S, NEB, New England Biolabs, USA) and 4.8 µL of nuclease-free water ...
-
bioRxiv - Immunology 2021Quote: ... 0.2 µL of RNase Inhibitor 40 U / µL (cat. n° M0314L, NEB, New England Biolabs, USA), 1 µL of ProtoScript II reverse transcriptase 200 U / µL (cat ...
-
bioRxiv - Immunology 2021Quote: ... 2 µL of random primer mix 60 µM (cat. n° S1330S, NEB, New England Biolabs, USA) and 4.8 µL of nuclease-free water ...
-
bioRxiv - Immunology 2021Quote: ... 0.2 µL of RNase Inhibitor 40 U / µL (cat. n° M0314L, NEB, New England Biolabs, USA), 1 µL of ProtoScript II reverse transcriptase 200 U / µL (cat ...
-
bioRxiv - Cell Biology 2022Quote: ... enzyme digestion or Peptide-N-Glycosidase F (PNGase F) (New England Biolabs, Ipswich, MA, catalog #: P0704L) enzyme digestion was performed according to manufacturer’s instruction and the published procedure [49].
-
bioRxiv - Plant Biology 2020Quote: ... were PCR amplified using Q5® High-Fidelity DNA Polymerase (New England Biolabs, Cat n° M0491) with oligonucleotide primers containing attB recombination sequences ...
-
bioRxiv - Immunology 2021Quote: ... the uridines present in one cDNA strand were digested with uracil- N-glycosylase (New England BioLabs), as described 67 ...
-
bioRxiv - Biochemistry 2022Quote: ... CBP (Chitin Binding Protein, produced by N. Martín in Dr. Casanova’s lab, New England Biolabs Protocol) was used as a secondary antibody at 1:300 to detect chitin and visualize the tracheal branches ...
-
bioRxiv - Biophysics 2022Quote: ... containing TwinStrep-SUMO at the N-terminus of S15 using the NEBuilder HiFi assembly protocol (NEB). TnsC clones were transformed into Escherichia coli BL21(DE3 ...
-
bioRxiv - Biochemistry 2023Quote: ... or β-N-acetylhexosaminidases (jack bean from Sigma-Aldrich, Streptomyces plicatus chitinase from New England Biolabs or in-house-produced recombinant Caenorhabditis elegans HEX-4 specific for β1,4-GalNAc-linked residues ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... with an N-terminal V5 tag and linker using Gibson Assembly (New England Biolabs, Ipswich, MA). Human RIPK4 (NP_065690.2 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... with an N-terminal V5 tag and linker using Gibson Assembly (New England Biolabs, Ipswich, MA). Kinase mutants for human proteins RIPK1 (D138N) ...
-
bioRxiv - Genomics 2024Quote: ... NEBNext Companion Module for Oxford Nanopore Technologies Ligation Sequencing (NEB, MA, United States, Cat N° E7180S), and AMPure XP beads (made in-house by the Molecular Biology Service ...
-
bioRxiv - Biochemistry 2024Quote: ... affinity-purified MBP-BTSL2-N-Strep was cleaved using Factor Xa protease (NEB, product no. P9010L) at a concentration of ∼2.8 ng/mL for 24 h at 4 °C ...
-
bioRxiv - Genetics 2024Quote: ... 4) IDS-KO receiving 1 mg/kg idursulfase IV and nebulized idursulfase (KO-NEB, n = 5). The nebulized idursulfase was delivered as 167 µL of 2 mg/mL ...
-
bioRxiv - Molecular Biology 2020Quote: ... padlock probe ligation was performed overnight O/N at 25°C using the SplintR ligase (NEB, M0375) at a final concentration of 0.5 Units/μl ...
-
bioRxiv - Biochemistry 2020Quote: 1 μg of N protein was dissolved in 36 μL H218O and 2 μL 10x glycobuffer (NEB). To this solution 2 μL PNGase F was added and the reaction mixture was incubated at 37 °C for 16 h ...
-
STARCH SYNTHASE 4 is required for normal starch granule initiation in amyloplasts of wheat endospermbioRxiv - Plant Biology 2021Quote: ... in frame with the N-terminal His6-tag using the Gibson assembly master mix (New England Biolabs) for TaSS4-1B ...
-
bioRxiv - Microbiology 2020Quote: ... and 2 μL of endo-β-N-acetylglucosaminidase-H (Endo-H, EC 3.2.1.96) (New England Biolabs™) and incubated in the thermomixer at 37 °C for one h ...
-
bioRxiv - Cell Biology 2020Quote: ... then deglycosylated with 2000 U of Peptide-N-Glycosidase F (PNGase F) (New England BioLabs, MA, USA). All samples were incubated for 16 hours at 37°C ...
-
bioRxiv - Biochemistry 2021Quote: The full-length PARP1 gene was purchased from GE Healthcare and subcloned into a pACEBac1 plasmid bearing an N-terminal 6xHis-tag via a Gibson Assembly (NEB). The PARP2 expression plasmid (C-terminal FLAG-6xHis-tag ...
-
bioRxiv - Molecular Biology 2022Quote: ... with a cleavable Glutathione-S-Transferase (GST) tag at the N-terminus) and pMALTMc5X (New England Biolabs, USA ...
-
bioRxiv - Neuroscience 2023Quote: ... Generation of Adgrd1 N-terminal mutations was carried out using Q5 site directed mutagenesis kit (NE Biolabs) using manufacturers protocol ...