Labshake search
Citations for New England Biolabs :
101 - 150 of 4267 citations for Mouse Chitinase 1 CHIT1 Protein since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... The immunoprecipitated protein was incubated with λ protein phosphatase using manufacturer’s protocol (Cat. # P0753S, NEB). The treated samples were resolved on SDS-PAGE and western blotting performed using OsFD7 antibody.
-
bioRxiv - Plant Biology 2022Quote: ... The protein extracts were incubated with Lambda Protein Phosphatase (λ-PPase) (NEB, Cat. No. P0753S) at 30 □ for 30 min and subsequently added 5×SDS sample buffer incubated at 95 □ for 5 min ...
-
bioRxiv - Developmental Biology 2020Quote: ... 75°C) with 0.5 μg mouse Cot-1 DNA supplemented with 10 mM vanadyl ribonucleoside complex (VRC) (NEB, S1402S) and 0.2 U μL−1 RNAseOUT (Invitrogen ...
-
bioRxiv - Biochemistry 2023Quote: ... The coding sequence of mouse PADI4 (residues 1-666) was amplified and cloned into pET28a vector using NdelI (NEB) and XhoI (NEB ...
-
bioRxiv - Biochemistry 2021Quote: ... mouse anti-MBP monoclonal (NEB), anti-mouse-HRP (Dianova) ...
-
bioRxiv - Biochemistry 2024Quote: ... mouse anti-MBP (E8032S; NEB) and Pierce mouse anti-HA (26183 ...
-
bioRxiv - Microbiology 2021Quote: ... which were incubated with 1 μg/ml full-length S protein with His tag that had been pretreated with or without FXa (P8010L, NEB) for 2 hours at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... Dephosphorylated RNA-protein complexes were then rinsed once with NT2 buffer and 3’-end ligated with T4 RNA Ligase 1 (NEB) overnight in an Eppendorf Thermomixer at 16°C ...
-
bioRxiv - Genomics 2021Quote: ... equal amount of naked DNA and DNA bound by Reb1 protein (~ 5pmol) were incubated with AAG (10 units) and APE1 (1 unit) (New England Biolabs) in a 20 μL reaction containing 1X Thermopol buffer (20mM Tris HCl pH 8.8 ...
-
bioRxiv - Genomics 2022Quote: ... for 2 hours and then crosslinked with p19 siRNA binding protein (1 μg/ml in depc-PBS; New England Biolabs) or anti-N6-methyladenosine (m6A ...
-
bioRxiv - Molecular Biology 2023Quote: ... TIS11B protein-RNA complexes were immunoprecipitated from 1 ml of crosslinked lysate and washed with high salt and PNK buffer (NEB). RNA was repaired by 3′ dephosphorylation and ligated to L3-IR adaptor on beads ...
-
bioRxiv - Biochemistry 2023Quote: ... Cleared lysate containing the nucleosomes was incubated with purified MBP-tag or MBP-FoxP3ΔN protein (1uM) for 1 hour at 4℃ and then subjected to MBP pulldown using Amylose Resin (New England Biolabs). After proteinase K (New England Biolabs ...
-
bioRxiv - Biophysics 2024Quote: ... On-column phosphatase treatment was performed by incubating the resin with 10 mL SEC buffer supplemented with 1 mM MnCl2 and 4,000 units (10 μL) Lambda Protein Phosphatase (LPP) (New England BioLabs P0753L) standing at 4°C overnight ...
-
bioRxiv - Molecular Biology 2024Quote: ... Protein-coding or lncRNA genes with adjusted P-value < 0.05 and absolute log2 fold change > 1 (NEB Directional RNA-seq) or with adjusted P-value < 0.05 and absolute log2 fold change > 0 (QuantSeq 3’ mRNA-seq ...
-
bioRxiv - Biophysics 2024Quote: ... Chromosome-bound proteins were degraded by flushing hypotonic solution supplemented with proteinase K (PKA, stock concentration of 800 units mL-1, NEB). The mix was prepared by adding 0.75 μL PKA to 20 μL hypotonic solution.
-
bioRxiv - Cell Biology 2020Quote: ... 1200 units λ-protein phosphatase (NEB) were diluted into phosphatase assay buffer without cell lysate ...
-
bioRxiv - Microbiology 2021Quote: ... Stained and unstained protein ladders (NEB; #P7719S and #P7717S ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1uL of lambda protein phosphatase (NEB) was added to samples ...
-
bioRxiv - Bioengineering 2021Quote: ... 90 nM of SpCas9 protein (NEB), NEB buffer 3.1 (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... and Cas9 protein (NEB - 0.3 μM). This was incubated at 37°C for 10 minutes before microinjection ...
-
bioRxiv - Genetics 2022Quote: ... and Cas9 protein (NEB - 0.3 μM). This was incubated at 37°C for 10 minutes before microinjection ...
-
bioRxiv - Microbiology 2022Quote: ... Color Prestained Protein Standard (NEB, P7719) or Precision Plus Protein All Blue Prestained Protein Standards (BioRad ...
-
bioRxiv - Microbiology 2020Quote: ... proteins were deglycosylated by PNGaseF (NEB) prior to gel electrophoresis ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Cas9 protein was purchased from NEB EnGen Cas9 NLS ...
-
bioRxiv - Microbiology 2023Quote: Protein expression vector pMAL-c5Xa (NEB) was used as the backbone for constructing the mCherry reporter ...
-
bioRxiv - Biochemistry 2022Quote: ... Protein markers (New England Biolabs, #P7719S) were used for molecular mass determination.
-
bioRxiv - Microbiology 2023Quote: ... proteins were deglycosylated by PNGaseF (NEB) prior to gel electrophoresis to facilitate analysis.
-
bioRxiv - Genomics 2024Quote: ... 90 nM of SpCas9 protein (NEB), NEB buffer 3.1 (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... and Protein Kinase A (NEB, P6000S) were purchased from New England Biolabs ...
-
bioRxiv - Bioengineering 2024Quote: ... including protein disulfide bond enhancer (NEB) and GamS (NEB) ...
-
bioRxiv - Genetics 2024Quote: ... 2 µl Cas9 Protein (M0386, NEB), 0.5µl buffer (NEB) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Proteins purified with amylose resin (NEB) and dialyzed overnight in Pho85-Pho80 dialysis buffer (10 mM Tris-HCl (pH7.4) ...
-
bioRxiv - Biochemistry 2024Quote: All proteins were expressed from NEB BL21(DE3 ...
-
bioRxiv - Developmental Biology 2021Quote: Subcloning Both full-length and truncated (1-160) mouse Naa12 were amplified from the pMAL-c5x Naa12 plasmid using Q5 HF Master Mix (NEB), AAAACCCGGGTATGAACATCCGCCGGGCTCGGC as the forward primer ...
-
bioRxiv - Microbiology 2024Quote: ... whereas rRNA-depleted RNA was prepared from 1 μg of total RNA using the NEBNext rRNA Depletion Kit v2 (Human/Mouse/Rat) (New England Biolabs). NGS libraries were generated from poly(A)+ RNA or rRNA-depleted RNA using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs ...
-
bioRxiv - Biophysics 2023Quote: ... Trypsin digestion was initiated by adding 1:10 (trypsin to protein, m/m) mass spectrometry grade trypsin (New England Biolabs #P8101S) in 50 mM ammonium bicarbonate ...
-
bioRxiv - Molecular Biology 2021Quote: Biotinylation of SNAP tagged proteins and Avi-tagged proteins were performed as suggested by manufactures (NEB, Avidity). Direct biotinylation of proteins for example-YenB ...
-
bioRxiv - Plant Biology 2020Quote: ... The NRPD1-Maltose Binding Protein (MBP) fusion protein was affinity purified using Amylose resin (New England Biolabs) and eluted with 20 mM maltose ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.5 µg of purified recombinant WRN protein was treated with Lambda Protein Phosphatase (LPP, New England Biolabs) in 1X PMP buffer (50 mM HEPES pH 7.5 ...
-
bioRxiv - Biochemistry 2024Quote: ... the concentrated protein at 3 mg/mL was incubated with c-AMP Protein Kinase A PKA (NEB) (molar ratio of 40:1 ...
-
bioRxiv - Zoology 2024Quote: ... Proteins were purified from cell lysates using the pMAL protein fusion and purification system (New England Biolabs). The MBP protein was also independently expressed in pMAL-c2x as control ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-myc (New England Biolabs), rabbit polyclonal anti- GFP (gift from Oliver Gruss ...
-
bioRxiv - Biochemistry 2020Quote: ... 50 μg of purified protein complexes were treated with 2,000 U of Lambda Protein Phosphatase (New England Biolabs) in 200 μl dephosphorylation buffer (50 mM HEPES-NaOH ...
-
bioRxiv - Systems Biology 2023Quote: ... the wild-type protein extracts were incubated with 40 units of Lambda Protein Phosphatase (New England Biolabs, P0753S) at 30°C for 30min ...
-
bioRxiv - Cell Biology 2024Quote: ... Protein lysates (500 µg) were subjected to precleaning using 25 µl Protein A (New England Biolabs, Cat # S1425S) and G (New England Biolabs ...
-
bioRxiv - Biochemistry 2022Quote: ... purified Trx-FER-KD and FER-KDK565R proteins were treated with 1 μl of λ-phosphatase (λ-PP) (400,000 units/ml, New England Biolabs. P0753S) and 1 mM MnCl2 for 1-2 h at room temperature ...
-
bioRxiv - Genetics 2020Quote: ... Zebrafish embryos were injected at the 1-cell stage with a 1 nL solution of bbs2 gRNA (200 ng/μL) and Cas9 protein (10 μM; New England BioLabs, Beverly, MA). Mutagenesis was confirmed by High Resolution Melt Analysis (HRMA ...
-
bioRxiv - Cell Biology 2020Quote: ... in protein kinase buffer (New England Biolabs) in the presence of 0.2 mM Mg2+-ATP and 1 µCi [γ32-P]ATP for 30 min at 30°C ...
-
bioRxiv - Cell Biology 2020Quote: ... in protein kinase buffer (New England Biolabs) and 0.5 mM Mg2+-ATP for 30 min at 30°C ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein Phosphatase Inhibitor 2 (New England Biolabs) and Trichostatin A HDAC inhibitor (TSA ...