Labshake search
Citations for New England Biolabs :
101 - 150 of 2329 citations for Human LACC1 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... The plasmid was digested with SpeI (NEB) and XmaI (NEB) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Enriched plasmids were digested with EcoRV (NEB) for 8 hrs at 37 °C ...
-
bioRxiv - Immunology 2022Quote: ... Plasmid pACYC177 (New England Biolabs, Ipswich, MA) was used to clone three fragments and a T7 promoter sequence (TAATACGACTCACTATAGGG ...
-
bioRxiv - Cell Biology 2022Quote: ... Plasmid pJV452 was constructed by Gibson (NEB) assembly of pEDJ400 linearized with oligos JV498+JV499 ...
-
Optimization and deoptimization of codons in SARS-CoV-2 and the implications for vaccine developmentbioRxiv - Evolutionary Biology 2022Quote: ... template plasmids were digested using DpnI (NEB). The wildtype and mutated viral sequence were constructed using overlap PCR ...
-
bioRxiv - Biochemistry 2020Quote: ... Plasmid DNA was digested using XbaI (NEB) to cut upstream of the T7 promoter ...
-
bioRxiv - Genetics 2020Quote: ... Plasmid was digested using Bbsl (NEB, R0539) and purified ...
-
bioRxiv - Molecular Biology 2022Quote: ... Plasmids were transformed into BL21 DE3 (NEB) and clones were picked for growth in 40 mL LB (Melford ...
-
bioRxiv - Microbiology 2022Quote: Plasmids were linearized by AflII digestion (NEB) and then transformed into PichiaPink™ Strain one (Invitrogen ...
-
bioRxiv - Systems Biology 2022Quote: ... the plasmids were digested with BsmBI (NEB) following manufacturer’s recommendations and the backbone DNA with sticky ends were then separated in 1% agarose gel and purified for later use ...
-
bioRxiv - Microbiology 2022Quote: Plasmids were linearized by AflII digestion (NEB) and then transformed into PichiaPink™ Strain one (Invitrogen ...
-
bioRxiv - Developmental Biology 2023Quote: ... after digesting the plasmid with BsmBI (NEB). The sgRNA was transcribed from the BamHI linearized pT7-gRNA vector using the MEGAshortscript T7 kit (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2023Quote: ... The plasmids were linearized using XhoI (NEB) and extracted by phenol/chloroform (1:1) ...
-
bioRxiv - Biochemistry 2023Quote: ... plasmids were transformed into BL21 (DE3) (NEB) or Rosetta2 (Novagen ...
-
bioRxiv - Bioengineering 2023Quote: ... with pUC19 plasmid (New England BioLabs, Inc.) was selected as the model stain ...
-
bioRxiv - Biophysics 2023Quote: Integration plasmids were linearized with PmeI (NEB) and transformed into yeast using the standard lithium acetate method57 ...
-
Size-Dependent Expression of the Fission Yeast Cdc13 Cyclin is Conferred by Translational RegulationbioRxiv - Cell Biology 2023Quote: ... Plasmids were created using Gibson Assembly (NEB) as detailed in Table 4.
-
bioRxiv - Biochemistry 2023Quote: ... Plasmid was subsequently linearized using BsaI (NEB), three times phenol chloroform extracted and then ethanol precipitated ...
-
bioRxiv - Microbiology 2023Quote: ... plasmids by Gibson assembly from NEB (#E2611L). The SDeV infectious clones with HA-tag C-terminally to either S-SDAg or the putative L-SDAg were constructed as 1.2x genome inserts in genomic orientation into pCAGGS vector similarly to what has been described for 1.2x genome SDeV14 ...
-
bioRxiv - Neuroscience 2023Quote: ... The pUC19 plasmid (NEB, Catalog number: N3041A) was then linearized with KpnI and BamHI and the 1.6kb amplified region was inserted into the linearized pUC19 vector ...
-
bioRxiv - Microbiology 2024Quote: ... digested pSFS2 plasmid using NEBuilder HiFi (NEB) as per manufacturer instructions ...
-
bioRxiv - Genomics 2023Quote: ... The resulting plasmids were miniprepped (NEB T1010L) and reacted with a barcoded pool of destination vectors (PB-CT3G-ERP2-MG-BC ...
-
bioRxiv - Cell Biology 2024Quote: ... gBLOCKs and the pSNAPf plasmid (NEB, N9183S) were both digested with NheI (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... plasmid backbone using Gibson Assembly (E2621L, NEB). These recombinant plasmids were then introduced into BAC-Optimized Replicator v2.0 electrocompetent cells (60210 ...
-
bioRxiv - Biophysics 2020Quote: ... from human origin were all purchased from NEB. The H2A/H2B and H3.1/H4 were mixed in 2(H2A/H2B)2:1(H3/H4)4 molar ratio to form octamers.
-
bioRxiv - Molecular Biology 2021Quote: ... Recombinant human histone H4 (New England Biolabs # M2504S) was used as a substrate ...
-
bioRxiv - Synthetic Biology 2019Quote: Reporter and sensor plasmids (including WT promoter plasmid) were cotransformed into DH10B cells (New England Biolabs Inc, Cat. C3020) using electroporation and then plated onto LB-agar plates with kanamycin (50 μg/mL ...
-
bioRxiv - Cell Biology 2022Quote: ... The mutated Rop1 expression plasmid and the amber suppressor tRNA plasmid were co-transformed into BL21 (DE3) cells (NEB), as described2 ...
-
bioRxiv - Microbiology 2022Quote: ... rodentium genomic intergenic sequence into plasmid pKD4 (addgene Plasmid #45605)(Datsenko and Wanner, 2000) using New England Biolabs (NEB) HiFi DNA Master Mix ...
-
bioRxiv - Immunology 2021Quote: ... The plasmid for expressing mutant nvDae4 (C63A) was made from the pAcGP67-A-nvDae4 plasmid using Q5 site-directed mutagenesis (NEB) according to the manufactures protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... The relaxed plasmid in control samples was generated by treatment of the supercoiled plasmid with RNase H2 (New England Biolabs) for 2 hours at 37°C ...
-
bioRxiv - Bioengineering 2019Quote: ... the GFP cassette between KpnI/HpaI restriction sites of plasmid GFP-Fibrillarin was replaced with a 730 bp Cerulean cassette PCR amplified from plasmid pCerulean-N1 (New England Biolabs) using primer pair ForCerFib/RevCerFib ...
-
bioRxiv - Biochemistry 2019Quote: ... was amplified from the above H6-TtBac pET15b plasmid and was cloned into plasmid pHis17 using Gibson Assembly (New England Biolabs) with a stop codon before the C-terminal tag on the plasmid ...
-
bioRxiv - Genomics 2019Quote: ... Plasmid templates for additional temperature range testing were generated by linearizing the pwtCas9 plasmid (Qi) using XhoI (New England Biolabs).
-
bioRxiv - Bioengineering 2021Quote: ... recognition sequence was inserted into a non-coding region of the pETh oncocin plasmid to enable nicking mutagenesis (Supplementary Table 2).43 The pETh oncocin plasmid was digested with SphI (NEB), and the BbvCI recognition sequence was inserted via NEBuilder® HiFi DNA Assembly (NEB).
-
bioRxiv - Immunology 2021Quote: ... Two restriction sites NheI at the 5’ end and BamHI at the 3’ end were incorporated into the CD4-polypeptide linker plasmid which was then inserted into pACP-tag(m)-2 plasmid (New England Biolabs) to obtain pACP-CD4 ...
-
bioRxiv - Cell Biology 2020Quote: The ACP sequence from the ACP-GPI plasmid [25] was incorporated to the HIR plasmid previously described [24] by the Gibson assembly (New England Biolabs). The HIR (Homo sapiens ...
-
bioRxiv - Microbiology 2021Quote: ... PCR fragments were either digested using restriction endonucleases and ligated into the respective plasmid backbone or assembled directly into a linearised plasmid backbone using Gibson assembly (NEBuilder HiFi DNA Assembly, NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... 3’UTR fragment was assembled into a plasmid (VRQRABE-mRNA plasmid) using NEBuilder HiFi DNA Assembly Master Mix (NEB, E2621S) according to manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2021Quote: Site directed mutagenesis for Ser247Thr mutation on hMAT2A plasmid and Thr227Ser mutation on eMAT plasmid was carried out using Q5 Site-Directed Mutagenesis Kit (NEB) by following kit protocol and expressed ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plasmid #90097) after the plasmid digestion by BamHI and NotI with NEBuilder HiFi DNA Assembly Cloning Kit (New England Biolabs). The expression constructs were transformed into BL21 (DE3 ...
-
bioRxiv - Genomics 2022Quote: ... We next added a library of random barcodes to the plasmid by digesting the plasmid with XbaI followed by HiFi assembly (New England Biolabs) with a single-stranded oligo containing 16 random N’s (Location barcodes ...
-
bioRxiv - Synthetic Biology 2023Quote: ... using 55 fmol of purified cassette after BbsI-HF (for photoautotrophy screening with p1 plasmids) or BsaI-HF (for antibiotic screening with pM plasmids) digestion (New England Biolabs) of the corresponding plasmid ...
-
bioRxiv - Cell Biology 2023Quote: ... Linearization of auxotrophic marker integration plasmids by treatment of plasmids pOS7 and pOS642 with the restriction enzymes StuI and BstII (NEB) were transformed for generation of ORS1150 and ORS1787 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Subsequent mutant versions of the JUN reporter plasmids were made by amplifying the plasmid using overlap-extension PCR with Q5 High-Fidelity DNA Polymerase (NEB) and primers containing the corresponding mutations ...
-
bioRxiv - Cell Biology 2023Quote: ... Cas9 plasmids targeting sequences BLTP2 open reading frame were prepared by digesting pSpCas9(BB)-2A-Puro plasmid with BbsI (R3539S, NEB) and inserting duplexed primers caccGAGCCAAACACGGTTCCGGA and aaacTCCGGAACCGTGTTTGGCTC or caccGTGCAAGATCTGACGCCGAC and aaacGTCGGCGTCAGATCTTGCAC ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli culture carrying the gRNA plasmids was cultivated for ∼12 hours in LB medium before plasmids were extracted via mini-prep (New England Biolabs).
-
bioRxiv - Cell Biology 2024Quote: ... domain from pmEGFP-N1-R-MCD(+0.2) plasmid (kind gift from Dr. Gregory Jedd) and cloned into XLone-GFP plasmid using Gibson assembly kit (NEB, E2611S). Two days after nucleofection ...
-
bioRxiv - Immunology 2022Quote: ... with short homologies for Gibson assembly and cloned into human IgG1 or human IgL2 expression vectors using the NEB Hifi DNA Assembly mix (NEB, Cat#E2621L). Plasmid sequences were verified by Sanger sequencing (Genewiz).
-
bioRxiv - Biophysics 2021Quote: ... we nicked the plasmid with nt.BspQI (NEB, R0644S), 2 hours 60°C and heat inactivated for 20 minutes 80°C ...