Labshake search
Citations for New England Biolabs :
101 - 150 of 10000+ citations for Human Gap Junction Alpha 8 Protein CX50 GJA8 ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... was amplified and barcoded in parallel using the same PCR program in 50 μL PCR reaction (2 μL gap-repaired DNA, 25 μL 2× NEBNext High-Fidelity PCR Master Mix (NEB), 1.5 μL 10 μM i5 universal PCR primer ...
-
bioRxiv - Microbiology 2022Quote: ... the transposon–genome junctions were enriched by PCR and indexed using NEBNext Multiplex Oligos (NEB #E7600S, New England Biolabs). The libraries were quantified by the University of Michigan Advanced Genomics Core using the Agilent TapeStation system (Agilent ...
-
bioRxiv - Microbiology 2022Quote: ... the transposon–genome junctions were enriched by PCR and indexed using NEBNext Multiplex Oligos (NEB #E7600S, New England Biolabs). The libraries were quantified by the University of Michigan Advanced Genomics Core using the Agilent TapeStation system (Agilent ...
-
bioRxiv - Plant Biology 2023Quote: ... For grafting junction libraries: mRNA isolation was performed using NEBNext® Poly(A) mRNA Magnetic Isolation Module (NEB #E7490S), followed directly by using NEBNext Ultra Directional RNA Library Prep Kit for Illumina (NEB #E7760S ...
-
bioRxiv - Synthetic Biology 2024Quote: ... of PCR products carrying complementary USER junctions were mixed in a 10 μl reaction containing 0.75 units DpnI (New England Biolabs), 0.75 units USER enzyme (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Escherichia coli competent cells NEB 5-alpha (C2987, New England Biolabs), NEB Stable (C3040 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Plasmids were transformed into either competent NEB 5-alpha F’Iq (NEB) or Epi400 (Lucigen) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and were performed using 5-alpha F’ Iq cells (NEB C2992H).
-
bioRxiv - Biochemistry 2021Quote: ... The assembled product was transformed into 5-alpha competent cells (NEB) and the insert sequence was confirmed by Sanger sequencing (Source Bioscience) ...
-
bioRxiv - Molecular Biology 2022Quote: ... DNA was transformed into NEB 5-alpha cells (New England Biolabs) and plated on LB plates with carbenicillin for selection purposes and incubated overnight at 37 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... and then transformed into 5-alpha competent Escherichia coli cells (NEB), according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... it was transformed into NEB 5-alpha competent E.coli (NEB #C2987). The sequence of donor plasmid was confirmed by Sanger sequencing using 5 primers to ensure that there are no disabling mutations in the scarless DsRed cassette or regions of the homology arms ...
-
bioRxiv - Immunology 2022Quote: ... and then transformed in NEB 5-alpha competent cells (NEB, C2987U). Expi293F (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... coli host strain NEB 5-alpha F’ lq (New England Biolabs) was exclusively used to generate ...
-
bioRxiv - Genomics 2021Quote: ➢ Distinct from currently used length 8 barcodes from common library kits (Illumina TruSeq, NEB)
-
bioRxiv - Synthetic Biology 2023Quote: Protein expression was performed with the PURExpress In Vitro Protein Synthesis kit (E6800, NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2020Quote: ... Plasmids were constructed by gap repair either through in vivo recombination or the NEBuilder plasmid assembly tool (New England Biolabs, USA). Linear products were created by PCR with primers from Sigma Life Science and Q5 Polymerase (New England Biolabs ...
-
bioRxiv - Microbiology 2024Quote: ... The 12 μl of size-selected metagenomic DNA fragments were gap-filled by the addition of 12 μl of 2x Q5 DNA polymerase (New England Biolabs, M0492S) (pre-incubated at 98°C for 30 seconds ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... 1:8 dilution Cas9 protein (New England Biolabs, cat. M0386M; diluted in buffer B, New England Biolabs, cat. B802S) and 1:40 dilution of phenol red (Sigma Aldrich) ...
-
bioRxiv - Microbiology 2023Quote: ... MARCH2 chimeras containing the TM domains from either human MARCH4 or human transferrin receptor (TR) were generated using the NEBuilder HiFi DNA assembly kit (New England Biolabs) and the primers listed in Supplemental Table S2 ...
-
bioRxiv - Genetics 2023Quote: ... PCR primers were designed to specifically amplify the tandem duplication junctions for each family using Longamp Taq Polymerase (New England Biolabs), then Sanger sequenced (Eurofins Genomics ...
-
bioRxiv - Molecular Biology 2023Quote: ... The AGO2-HaloTag junction region of this genomic DNA was amplified in a 25 µl Phusion Hot Start Flex (M05365S, NEB) PCR reaction as per the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... with recombinant proteins (200-500 ng) and yeast purified CK2 or recombinant human CK2 (NEB, P6010S). Proteins were resolved by SDS-PAGE and the gels were exposed to autoradiography or stained with Coomassie blue.
-
bioRxiv - Microbiology 2021Quote: ... Clones were selected and maintained in E.coli strain NEB5-alpha (NEB, C2987I). All constructs were verified by Sanger sequencing (Eurofins) ...
-
bioRxiv - Microbiology 2021Quote: ... Ligations were used to transform NEB 5-alpha competent cells (NEB C2987H) and the cloned spacer was verified by Sanger sequencing using primer PSP108 ...
-
bioRxiv - Microbiology 2021Quote: ... Assemblies were transformed into DH5-alpha chemically competent cells (New England Biolabs) and correct clones were identified by restriction profile and Sanger sequencing (Genewiz ...
-
bioRxiv - Molecular Biology 2020Quote: ... transformed into NEB 5-alpha chemically competent Escherichia coli (New England BioLabs), and submitted for Sanger sequencing (Eurofins Genomics ...
-
bioRxiv - Microbiology 2020Quote: ... DNA was transformed into NEB 5-alpha high efficiency competent cells (NEB). Insert size was verified with PCR and purified plasmids were sequenced using Sanger sequencing.
-
bioRxiv - Microbiology 2023Quote: The strain Escherichia coli NEB 5-alpha (New England Biolabs, NEB C2987H) was used as a cloning strain ...
-
bioRxiv - Microbiology 2023Quote: The strain Escherichia coli NEB 5-alpha (New England Biolabs, NEB C2987H) was used as a cloning strain ...
-
bioRxiv - Molecular Biology 2023Quote: ... coli competent cells (NEB 5-alpha, New England Biolabs, Ipswich, MA, USA) that were cultured and prepared using a GenElute HP Plasmid Midi kit (NA0200-1KT ...
-
bioRxiv - Systems Biology 2024Quote: ... Each construct was transformed into standard 5-alpha competent bacteria (#C2987; NEB) grown overnight in in 500 ml of standard Luria Broth (LB ...
-
bioRxiv - Molecular Biology 2022Quote: ... gap fill enzymes were added (1U Sulfolobus DNA Polymerase IV NEB cat# M0327S and 10U E. coli DNA Ligase NEB cat# M0205L) and incubation continued for an additional 30min at 37°C ...
-
bioRxiv - Neuroscience 2022Quote: ... or the NEBNext® rRNA Depletion Kit (Human/Mouse/Rat)(E6350, NEB) (replicates 4-5 and no salt treatment ...
-
bioRxiv - Molecular Biology 2022Quote: ... we used NEBNext® rRNA Depletion Kit (Human/Mouse/Rat) (NEB #E7405), NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina® (NEB #E7765 ...
-
bioRxiv - Cancer Biology 2024Quote: ... ribosomal RNA depleted using NEBNext rRNA Depletion Kit (NEB, Human/Mouse/Rat) and strand-specific library preparation used NEBNext Ultra II mRNA kit (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... and vcircRNA873/1151 (oligonucleotide probe 5’- CAGGACAACAGGGCCAGCAAGGTGGCGGACATCACAACCA-3’ against the junction) were performed using γ-32P-dATP-end labeled (PNK kinase, NEB) probes ...
-
bioRxiv - Genomics 2024Quote: ... We amplified target sequences by PCR using primers designed to span alternatively spliced junctions (FP-5’AGAACGGCAACTCCAATGGC3’ and RP-5’GCCAGTCTCCTTGTCAATGA3’) and Quick load Taq 2X Master mix (#M0271L, NEB, USA) according to the manufacturer’s protocol (28 cycles) ...
-
bioRxiv - Genomics 2023Quote: ... We amplified target sequences by PCR using primers designed to span alternatively spliced junctions (Fig S4) listed in Table S11 and Quick load Taq 2X Master mix (#M0271L, NEB, USA) according to the manufacturer’s protocol (28 cycles) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The ligation was directly transformed into NEB-5-alpha electrocompetent cells (NEB C2987H) and plated on LB-agar supplemented with carbenicillin (100 µg/mL) ...
-
bioRxiv - Biochemistry 2023Quote: ... The plasmids were then transformed into DH5-alpha high-efficiency competent cells (NEB). Following transformation ...
-
bioRxiv - Biochemistry 2023Quote: ... NEB Stable (lentiviral vectors) and NEB 5-alpha (other plasmids) (New England Biolabs) were used as cloning strains ...
-
bioRxiv - Biochemistry 2021Quote: ... The RNAs were recovered from the gel slices by digesting the protein with proteinase K (8 U; P8107S, NEB, Ipswich, MA) leaving a polypeptide remaining at the crosslinked nucleotide ...
-
bioRxiv - Genetics 2020Quote: ... following rRNA depletion using a NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB).
-
bioRxiv - Molecular Biology 2023Quote: ... Human FBP1 mutants were constructed by Q5 Site-Directed Mutagenesis Kit (NEB, E0554S) in the PCDH-V5-FBP1 vectors ...
-
bioRxiv - Genomics 2024Quote: A NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (Cat# E6310X, New England Biolabs) was used to deplete rRNA from the previously prepared total RNA ...
-
bioRxiv - Evolutionary Biology 2021Quote: Both HLS-C and HLS-E protein at 1 mg/mL were incubated with human Furin (EC 3.4.21.75, P09958, obtained from NEB P8077) in digestion buffer (10 mM HEPES (pH 7.5) ...
-
bioRxiv - Microbiology 2022Quote: Experiments with PURExpress in vitro protein synthesis kit (NEB, E6800) were performed as per the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2022Quote: We used PURExpress In Vitro Protein Synthesis Kit (NEB, E6800L) and the reaction was set up with the following manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... proteins were removed using the Monarch RNA Cleanup Kit (NEB) and 5’-mono-phosphorylated v51_mut_S templates were specifically digested with a terminator 5’-phosphate-dependent exonuclease (Biosearch technologies ...