Labshake search
Citations for New England Biolabs :
101 - 123 of 123 citations for Hepatitis B Virus Core Antigen HBcAg since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... DOM-A and DOM-B K945G mutants were generated by site-directed mutagenesis (New England Biolabs, Cat. No E0554S). For transfection in Drosophila cells ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was sheared by incubating the nuclei in 100 µl of buffer B supplemented with 1,000 units of micrococcal nuclease (M0247S; NEB) for 30 min at 37°C ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 8 μL of solution A and 6 μL of solution B were mixed with 16 U RNase Inhibitor (NEB), gBlock templates (2 nM each ...
-
bioRxiv - Genomics 2023Quote: ... Then equal amounts of purified linear A and B PCR products were mixed with the Taq DNA ligase (NEB) and its buffer ...
-
bioRxiv - Biochemistry 2021Quote: ... proteins were expressed as N-terminal His6-Smt3 fusion constructs from either pET28-b vectors (expressed in T7 Express lysY/Iq (NEB) Escherichia coli (E ...
-
bioRxiv - Biochemistry 2021Quote: ... 1000 base pairs upstream and downstream from the clpP2 gene were amplified by PCR using the A–B and C–D primer pairs from table 3 (Phusion polymerase, GC buffer, New England Biolabs). The PCR products were purified with E.Z.N.A ...
-
bioRxiv - Biochemistry 2021Quote: ... 700 bp upstream and downstream were amplified using the A–B and C–CD primer pairs from Table 2 (Phusion polymerase, GC buffer, New England Biolabs). The 2×myc tag was added to the B primers as overhangs ...
-
bioRxiv - Microbiology 2020Quote: ... Cell pellets were resuspended in 1 ml of iCLIP lysis buffer B (same as buffer A but with 1% v/v NP-40 and 11 μl of Murine RNase inhibitor (NEB) per 1 ml ...
-
bioRxiv - Immunology 2022Quote: ... ligated in EcoRI-digested pCCLc-MND-X (A kind gift from Dr. Donald B. Kohn) and transformed using NEB-5alpha cells (NEB). Inserts were verified using MND_Input_Verify_F and MND_Input_Verify_R ...
-
bioRxiv - Immunology 2022Quote: RNA was extracted from IgG1 stimulated B cells 72 hour post-stimulation using TRIzol reagent (Fisher) and cDNA was prepared using the Protoscript II kit (NEB). Germline transcription was analyzed using quantitative PCR with SYBR Green (Roche ...
-
bioRxiv - Immunology 2022Quote: ... and Illumina linker addition to B cell heavy chain transcripts were performed using the human NEBNext Immune Sequencing Kit (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... The entry module pGG-B-AtU6-26-BRI1-2-C and pGG-A-AtU6-26-BRI1-3-B were generated by annealing oligos for each gRNA and ligating into BbsI-digested (New England Biolabs) Golden Gate entry vectors described in (66) ...
-
bioRxiv - Microbiology 2023Quote: ... and a 1848 bp fragment (containing the 1131 bp Pfcytb open reading frame) was amplified with primers (SI Appendix, Fig. S2A,B) and Phusion DNA polymerase (NEB). PCR product was verified by gel electrophoresis as single band of predicted size ...
-
bioRxiv - Microbiology 2023Quote: ... These PCRs were performed with the specified primer sets (a, c and e or b, d and f) and Q5 High-Fidelity Polymerase (NEB) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Type I-F Cascade was co-expressed with 6xHis-MBP-TEV-TniQ and a type III-B crRNA in NiCo21 cells (NEB). Cells were then induced with 0.5 mM isopropyl at 18 °C for another 18–20 hours before harvesting ...
-
bioRxiv - Neuroscience 2024Quote: ... a V5 tag was inserted after the start codon of Ten-m cDNA (isoform B) in the plasmid pUAST-attB-Ten-m5 using the Q5 site-directed mutagenesis kit (New England Biolabs). To generate the UAS-V5-Ten-m-ΔICD and UAS-V5-Ten-m-ΔECD constructs ...
-
bioRxiv - Biophysics 2024Quote: ... The gene fragments were individually cloned into sensor plasmid backbones identical to those used in the previous identification of non-functional TetR(B) mutants following the manufacturers protocol for Gibson Assembly (New England Biolabs). The newly constructed plasmids carrying each of the combined mutants were then transformed into E ...
-
bioRxiv - Biochemistry 2020Quote: GQES7-a and GQES7-b were synthesized in vitro by transcription (HiScribe™ T7 High Yield RNA Synthesis Kit; New England Biolabs). GQes3 and mutes3 ...
-
bioRxiv - Genomics 2021Quote: ... TF motif libraries in pGL4.10-Sasaki-SS (a) and pCpG-free-EF1α-SS (b) vectors were amplified using standard Illumina Universal and index primers (NEB #E7335S) and sequenced using standard Illumina chemistry ...
-
bioRxiv - Biochemistry 2023Quote: ... XBP1 Part A and Part B were produced by adding a T7 promoter sequence (TAATACGACTCACTATAGGG) and using the HiScribe T7 RNA Synthesis Kit (NEB E2040S). Template DNA was digested by adding DNase I and incubation for 15 min at 37 °C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... (fhuA2 [lon] ompT gal (lambda DE3) [dcm] ΔhsdSlambda DE3 = lambda sBamHIo ΔEcoRI-B int::(lacI::PlacUV5::T7 gene1) i21 Δnin5) (New England Biolabs, C2527I) were used ...
-
bioRxiv - Genetics 2024Quote: ... The B splice form (Spc105RB) was generated using site directed mutagenesis to delete the first intron from the A form (NEB BaseChanger Kit). All mutants were generated using site specific mutagenesis of the A- or B-form Spc105R coding region in the pENTR4 vector ...
-
bioRxiv - Biochemistry 2021Quote: ... 1000 base pairs upstream and downstream from the C-terminus of clpP1 were amplified by PCR using the A–B and C–D primer pairs from Table 2 (Phusion polymerase, GC buffer, New England Biolabs, Ipswich, United States). For clpP2 ...