Labshake search
Citations for New England Biolabs :
101 - 150 of 162 citations for 7 bromomethyl benzo b phenanthrene since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: AP-DNA was prepared by incubating 50 μM 7-mer ssDNA [d(GTCUGGA]] with 10 U of uracil DNA glycosylase (UDG, New England Biolabs) in UDG Buffer at 37 °C for 1.5 h ...
-
bioRxiv - Genomics 2022Quote: ... The long RNAs were then fragmented to 70-100 nt by using an NEBNext Magnesium RNA Fragmentation Module (94 °C for 7 min; New England Biolabs). After clean-up by using a Zymo RNA Clean & Concentrator kit (8X ethanol protocol) ...
-
bioRxiv - Immunology 2022Quote: ... DNA amplifications for the M8 amplicon were also performed similarly except Q5TM polymerase (5.3×10-7 approximate error/bp; New England BioLabs, USA) was utilized ...
-
bioRxiv - Cell Biology 2021Quote: ... COS-7 cell lysates from FLAG-ACBD4/5 (mFFAT) expressing cells were treated for 1 h with λPP (New England BioLabs) as described above ...
-
bioRxiv - Biophysics 2021Quote: ... The 5’-terminus was capped with a type I 7-methylguanosine cap (m7G) using the Vaccinia Capping System (NEB, M2080S) and 2’-O-methyltransferase (NEB ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... CDS plus 7–9 bp of untranslated sequence were amplified using High Fidelity Phusion Taq (New England BioLabs, NEB, USA), 3% DMSO vol/vol ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... CDS plus 7–9 bp of untranslated sequence were amplified using High Fidelity Phusion Taq (New England BioLabs, NEB, USA), 3% DMSO vol/vol ...
-
bioRxiv - Cancer Biology 2021Quote: ... samples were mixed with 7 μl 5x Ultra II FS buffer and 2 μl Ultra II FS enzyme (New England BioLabs), and incubated 12 minutes at 37 °C followed by 30 minutes at 65 °C ...
-
bioRxiv - Genomics 2020Quote: ... PCR primers were designed using the Oligo 7 software and PCR was performed using Long-Amp Taq DNA polymerase (New England Biolabs) following the manufactures directions ...
-
On the causes, consequences, and avoidance of PCR duplicates: towards a theory of library complexitybioRxiv - Molecular Biology 2022Quote: ... Custom P1 adapters containing a 7-bp unique barcodes (Hohenlohe, Bassham, Currey, & Cresko, 2012) were ligated to each individual sample using a T4 ligase (NEB). The 150 robin samples were pooled at equimolar concentrations ...
-
bioRxiv - Molecular Biology 2022Quote: ... A total of 50 unit of T4 DNA ligase along with 7 μl of 20 ng/μl of BSA (Biolabs) and 7 μl of 100 mM ATP were added to reach a final volume of 700μl ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were generated by 7-9 rounds of PCR amplification using NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L), purified using SPRIselect reagent kit (Beckman Coulter ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were generated by 5-7 rounds of PCR amplification using NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L), purified using SPRIselect reagent kit (Beckman Coulter ...
-
bioRxiv - Genetics 2023Quote: ... We next linearized pattB-DSCP-QF#7-hsp70 (Plasmid #46133)123 using BamHI and NsiI and with Gibson Assembly (NEB) cloned R49E06 promoter in the plasmid.
-
bioRxiv - Cell Biology 2023Quote: ... and PCR amplified for 7-9 cycles depending on the samples using NEBNext High Fidelity 2× PCR master mix (New England Biolabs). The optimal cycle number was determined empirically each time by qPCR ...
-
bioRxiv - Biochemistry 2023Quote: ... the first round of PCR consisted of 7 cycles of the following program using Q5 High-Fidelity DNA Polymerase (New England Biolabs). Step1 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Ligation was performed on a 7-fold dilution of HindIII-digested chromatin using 100 units of Quick T4 DNA ligase (New England Biolabs) at 16°C for 16 hours ...
-
bioRxiv - Microbiology 2023Quote: ... The radioactive probe was prepared from 40 pmoles of primers described in Supplementary Table 7 and labeled at the 5’ end with 10 units of T4 polynucleotide kinase (New England Biolabs) and [γ- 32P]-ATP (150 µCi) ...
-
bioRxiv - Neuroscience 2023Quote: ... GDNA was isolated from 7 dpf efemp1+/+ or efemp12C-Cas9 zebrafish eyes using a Monarch Genomic DNA Purification Kit (T3010S; NEB) and quantified using a Nanodrop 1000 (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2023Quote: Assessment of the integration status of the HPV-positive HNSCC cell lines was characterized for each cell line and digested with 7 µg of total genomic DNA at 37°C overnight (20 hours) with either EcoRV (New England BioLabs) or Bam HI ...
-
bioRxiv - Immunology 2023Quote: ... and subsequently modified by the addition of a 7-methylguanosine cap with the Vaccinia Capping System (New England Biolabs [NEB]) using the NEB Capping protocol (NEB ...
-
bioRxiv - Genomics 2023Quote: ... all final Illumina compatible ERα STARRseq and ERα-focused STARR-seq capture libraries were prepared by PCR amplification (7 cycles) with NEBNext universal and single indexing primers (NEB), and were sequenced on Illumina NovaSeq 6000 (150bp Paired-End).
-
bioRxiv - Genomics 2023Quote: ... PCR amplification was performed for 7-11 cycles (depending on input DNA concentration) using NEBNext Mulitplex Oligos (New England Biolabs). Indexed sample concentration was quantified using the KAPA Library Quantification Complete Kit (Universal)(Roche) ...
-
bioRxiv - Immunology 2023Quote: ... and subsequently modified by the addition of a 7-methylguanosine cap with the Vaccinia Capping System (New England Biolabs [NEB]) using the NEB Capping protocol (NEB ...
-
bioRxiv - Neuroscience 2024Quote: Total RYR1 transcripts were amplified as 7 overlapping PCR products.38 They were sequenced after fragmentation and library preparation using NEBNEXT NGS workflow (New England Biolabs) according to manufacturer recommendation ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Custom P1 adapters containing unique 7-bp barcodes (Hohenlohe, Bassham, Currey, & Cresko, 2012) were ligated to each individual sample with T4 ligase (New England Biolabs). The DNA from all uniquely barcoded individuals in a library was pooled at equimolar concentration ...
-
bioRxiv - Biochemistry 2021Quote: ... proteins were expressed as N-terminal His6-Smt3 fusion constructs from either pET28-b vectors (expressed in T7 Express lysY/Iq (NEB) Escherichia coli (E ...
-
bioRxiv - Biochemistry 2021Quote: ... 1000 base pairs upstream and downstream from the clpP2 gene were amplified by PCR using the A–B and C–D primer pairs from table 3 (Phusion polymerase, GC buffer, New England Biolabs). The PCR products were purified with E.Z.N.A ...
-
bioRxiv - Biochemistry 2021Quote: ... 700 bp upstream and downstream were amplified using the A–B and C–CD primer pairs from Table 2 (Phusion polymerase, GC buffer, New England Biolabs). The 2×myc tag was added to the B primers as overhangs ...
-
bioRxiv - Microbiology 2020Quote: ... Cell pellets were resuspended in 1 ml of iCLIP lysis buffer B (same as buffer A but with 1% v/v NP-40 and 11 μl of Murine RNase inhibitor (NEB) per 1 ml ...
-
bioRxiv - Immunology 2022Quote: ... ligated in EcoRI-digested pCCLc-MND-X (A kind gift from Dr. Donald B. Kohn) and transformed using NEB-5alpha cells (NEB). Inserts were verified using MND_Input_Verify_F and MND_Input_Verify_R ...
-
bioRxiv - Immunology 2022Quote: RNA was extracted from IgG1 stimulated B cells 72 hour post-stimulation using TRIzol reagent (Fisher) and cDNA was prepared using the Protoscript II kit (NEB). Germline transcription was analyzed using quantitative PCR with SYBR Green (Roche ...
-
bioRxiv - Immunology 2022Quote: ... and Illumina linker addition to B cell heavy chain transcripts were performed using the human NEBNext Immune Sequencing Kit (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... The entry module pGG-B-AtU6-26-BRI1-2-C and pGG-A-AtU6-26-BRI1-3-B were generated by annealing oligos for each gRNA and ligating into BbsI-digested (New England Biolabs) Golden Gate entry vectors described in (66) ...
-
bioRxiv - Microbiology 2023Quote: ... and a 1848 bp fragment (containing the 1131 bp Pfcytb open reading frame) was amplified with primers (SI Appendix, Fig. S2A,B) and Phusion DNA polymerase (NEB). PCR product was verified by gel electrophoresis as single band of predicted size ...
-
bioRxiv - Microbiology 2023Quote: ... These PCRs were performed with the specified primer sets (a, c and e or b, d and f) and Q5 High-Fidelity Polymerase (NEB) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Type I-F Cascade was co-expressed with 6xHis-MBP-TEV-TniQ and a type III-B crRNA in NiCo21 cells (NEB). Cells were then induced with 0.5 mM isopropyl at 18 °C for another 18–20 hours before harvesting ...
-
bioRxiv - Neuroscience 2024Quote: ... a V5 tag was inserted after the start codon of Ten-m cDNA (isoform B) in the plasmid pUAST-attB-Ten-m5 using the Q5 site-directed mutagenesis kit (New England Biolabs). To generate the UAS-V5-Ten-m-ΔICD and UAS-V5-Ten-m-ΔECD constructs ...
-
bioRxiv - Biophysics 2024Quote: ... The gene fragments were individually cloned into sensor plasmid backbones identical to those used in the previous identification of non-functional TetR(B) mutants following the manufacturers protocol for Gibson Assembly (New England Biolabs). The newly constructed plasmids carrying each of the combined mutants were then transformed into E ...
-
bioRxiv - Genomics 2019Quote: ... Restriction digest was performed overnight at 37°C with agitation (950 rpm) with HindIII (NEB; 1500 units per 7 million cells). Using biotin-14-dATP (Life Technologies) ...
-
bioRxiv - Biochemistry 2019Quote: ... trp-31 his-1 rpsL104 xyl-7 mtl-2 metB1 Δ(mcrC-mrr)114::IS10 argE::Hsmar1-lacZ’-kanR] was derived from ER1793 (New England Biolabs).
-
bioRxiv - Developmental Biology 2023Quote: ... mRNA isolation module for samples with RINs greater than 7 and libraries were prepared using the NEBNext Ultra II directional RNA library preparation kit (NEB, E7760). QC was then performed on these libraries using Agilent Bioanalyzer 2100 and the libraries were quantified using fluorometric methods ...
-
bioRxiv - Biochemistry 2020Quote: GQES7-a and GQES7-b were synthesized in vitro by transcription (HiScribe™ T7 High Yield RNA Synthesis Kit; New England Biolabs). GQes3 and mutes3 ...
-
bioRxiv - Genomics 2021Quote: ... TF motif libraries in pGL4.10-Sasaki-SS (a) and pCpG-free-EF1α-SS (b) vectors were amplified using standard Illumina Universal and index primers (NEB #E7335S) and sequenced using standard Illumina chemistry ...
-
bioRxiv - Biochemistry 2023Quote: ... XBP1 Part A and Part B were produced by adding a T7 promoter sequence (TAATACGACTCACTATAGGG) and using the HiScribe T7 RNA Synthesis Kit (NEB E2040S). Template DNA was digested by adding DNase I and incubation for 15 min at 37 °C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... (fhuA2 [lon] ompT gal (lambda DE3) [dcm] ΔhsdSlambda DE3 = lambda sBamHIo ΔEcoRI-B int::(lacI::PlacUV5::T7 gene1) i21 Δnin5) (New England Biolabs, C2527I) were used ...
-
bioRxiv - Genetics 2021Quote: ... the poly (A) product was broken into pieces at 94 °C for 5-7 min using the Magnesium RNA Fragmentation Module (NEB, MA, USA). The RNA fragments were then reverse-transcribed using the SuperScript™ II Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... The radioactive probes were prepared by end labelling 10 pmoles of DNA oligonucleotide complementary to the sfRNA (Supplementary table 7) with [γ-32P]-ATP (Perkin-Elmer, USA) using T4 polynucleotide kinase (NEB, USA). Unincorporated nucleotides were then removed by gel filtration on Illustra MicroSpin G-25 Columns (GE Healthcare ...
-
bioRxiv - Immunology 2022Quote: ... The PCR enrichment of adaptor-ligated DNA was conducted with 7 cycles and NEBNext® Multiplex Oligos for Illumnina® (NEB, USA) for single end barcoding ...
-
bioRxiv - Microbiology 2020Quote: ... as previously described[7] Phage DNA libraries were prepared using NEBNext Ultra II FS library Prep and Kit for Illumina (New England Biolabs, Ipswich, USA). The sequencing was performed on the Illumina iSeq platform as part of a flowcell (2 x 151 ...