Labshake search
Citations for New England Biolabs :
101 - 150 of 7302 citations for 7 Diethylamino 3 5 6 dimethyl 2 benzoxazolyl 2H 1 benzopyran 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... 2 μg RNA were incubated for 30 minutes at 37°C with 2 μl RNA 5’ Pyrophosphohydrolase (NEB, M0356, 5,000 units/ml). The reactions were stopped by cleaning up the samples following the ZYMO RNA Clean & Concentrator-5 kit (ZYMO ...
-
BRD2 inhibition blocks SARS-CoV-2 infection by reducing transcription of the host cell receptor ACE2bioRxiv - Cell Biology 2021Quote: ... 5′-TAATCAGACAAGGAACTGATTA-3′ (Forward) and 5′-CGAAGGTGTGACTTCCATG-3′ (Reverse) were used with the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) in an Applied Biosystems QuantStudio 6 thermocycler or an Applied Biosystems StepOnePlus system ...
-
bioRxiv - Biochemistry 2021Quote: ... 5’-TAATCAGACAAGGAACTGATTA-3’ (Forward) and 5’-CGAAGGTGTGACTTCCATG-3’ (Reverse) were used with the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) in an Applied Biosystems QuantStudio 6 thermocycler ...
-
bioRxiv - Microbiology 2019Quote: ... Individual fragments were designed that possessed 5’ and/or 3’ sequence homology to one another using Q5 high-fidelity DNA polymerase (New England Biolabs), followed by stitching the individual fragments together in a SOE reaction.
-
bioRxiv - Plant Biology 2020Quote: ... epicentre cat # ER0720 or ER81050-we used this one) and A-tailing (100mM dATP; bioPioneer inc, Klenow; (3’-5’ exo- NEB) # M0212L (1,000 units ...
-
bioRxiv - Plant Biology 2022Quote: ... Four vectors including one of the active 5′gRNA-pairs and one of the active 3′gRNA-pairs were digested by BglI (New England Biolabs) and ligated at once ...
-
bioRxiv - Microbiology 2020Quote: ... 3 μL Klenow fragment (3’→5’ exo-) (NEB), and 9 μL of DEPC H2O to each reaction and incubating at 37 °C for 30 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 μl 10x NEBuffer 1 (New England Biolabs), 2 μl 50 mM MnCl2 ...
-
bioRxiv - Plant Biology 2021Quote: ... for 3 hours at 55°C and M-2 was digested with XhoI (NEB) overnight at 37°C ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA was ligated with 3′-adenylated adapters using T4 RNA Ligase 2 (NEB #MO351) for 4 hrs at 16°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5 µl 10 x dNTPs with dUTP instead of dTTP (2 mM each) and 1 µl T4 polymerase (NEB) were added and the mixture was incubated at 37°C in a thermal cycler for 20 min ...
-
bioRxiv - Genetics 2022Quote: ... 1 µL of extracted genomic DNAs and 5 µL of 2× Hot Start High Fidelity Q5 Master Mix (NEB). PCR reactions were carried out under the following condition ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 μL of 2% SDS and 2 μL of proteinase K (New England Biolabs) were added and the solution was incubated at 37°C for 1 hour before purification with the Qiagen DNA clean up kit ...
-
bioRxiv - Genomics 2022Quote: ... and the presence or absence of one of two RNAse inhibitors (1 – Millipore Sigma, Protector RNAse Inhibitor, Cat. No. 3335399001; 2 – NEB, RNAse Inhibitor, M0314S). The RNA was then extracted from the tissue using the miRNeasy kit (Qiagen Cat ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2 μl 10X NEBuffer 2 (New England Biolabs) and nuclease-free water (total of 20 μl ...
-
bioRxiv - Biophysics 2021Quote: ... and 3 samples from each replicate combined into 7 mL with 1 × T4 DNA Ligase Buffer (NEB), with 1% Triton X-100 ...
-
bioRxiv - Microbiology 2024Quote: ... Radioactively labelled tRNAs carrying a 2′,3′ cyclic phosphate at the 3′ end was dephosphorylated using T4 polynucleotide kinase (NEB) in 100 mM Tris-HCl pH 6.5 ...
-
bioRxiv - Cell Biology 2019Quote: ... 5 µl was used for BglII digestion (NEB, 2 hours at 37°C) and the products were loaded on a 2% agarose gel to confirm the pAS insertion ...
-
bioRxiv - Microbiology 2021Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2020Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-F ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2022Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-Forward ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-Reverse ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Cell Biology 2023Quote: ... one well of cells was sacrificed for direct lysis in 2% SDS blue loading buffer (New England Biolabs) and protein analysis of tau and β-III-tubulin (Sigma T-8660 ...
-
bioRxiv - Genomics 2019Quote: ... 3’-adenylation (Klenow Fragment 3’ to 5’ exo-, NEB), and ligation of indexed sequencing adaptors (Quick Ligation kit ...
-
bioRxiv - Biochemistry 2022Quote: ... D-loops were deproteinized by adding 2 μL of 5% lithium dodecyl sulfate and 1 μL of 20 mg/mL proteinase K (New England Biolabs), and incubating the mixture at 37°C for 15 min ...
-
bioRxiv - Bioengineering 2023Quote: ... Cells were washed two times in barcode wash buffer (+5 μM each of quenching oligo 1 & 2) and then resuspended in ice cold 1x ThermoPol reaction buffer (NEB) cells were passed through a 40μm strainer and counted ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 μL of GlycoBuffer 2 (NEB Cat # B0701S, 10X), 2 μL of 10% NP-40 (NEB Cat # B0701S ...
-
bioRxiv - Systems Biology 2024Quote: ... 2 µl of NEBuffer 2 (New England Biolabs B7002) and 1 µl of Klenow large fragment DNA polymerase (New England Biolabs M0210 ...
-
bioRxiv - Molecular Biology 2020Quote: 3’ linker ligation (1x PNK buffer, 800 u T4 RNA ligase 2 truncated KQ (NEB), 80 u RNaseOUT ...
-
bioRxiv - Molecular Biology 2023Quote: ... samples were incubated with 1.5 µl EndoH and 2 µl 10× GlycoBuffer 3 (all NEB) buffer at 37°C 1h ...
-
bioRxiv - Genomics 2020Quote: ... 1 µl T4 RNA Ligase 2 truncated (200U; NEB)] was added ...
-
bioRxiv - Biochemistry 2021Quote: ... disulfide bonding enhancer 1 and 2 (New England BioLabs), RNase inhibitor (Takara Bio Inc. ...
-
bioRxiv - Genomics 2021Quote: ... or 2 mU DNase 1 (Cat. No. M0303S; NEB) and 0 ...
-
bioRxiv - Biochemistry 2021Quote: ... were 3′ end-radiolabeled by incubation for 1 hr at 16°C with 1.11 MBq [5′-32P] cytidine-3′,5-bisphosphate (222 TBq mmol−1, Hartmann Analytic) and 10 units T4 RNA ligase 1 (NEB) in a total reaction volume of 20 µl containing 15% (v/v ...
-
bioRxiv - Synthetic Biology 2021Quote: ... USA). DNA amplification from a single colony (i.e. colony PCR) was performed with One Taq 2× Master Mix (NEB). Electrocompetent P ...
-
bioRxiv - Cell Biology 2023Quote: ... 250 μL of 2 mg mL-1 Y289L GalT,46 50 μL of 500 kU mL-1 PNGase F (New England Biolabs, 5 U μg-1 of protein), and 62.5 μL of Lambda Protein Phosphatase (New England Biolabs ...
-
bioRxiv - Cancer Biology 2020Quote: ... Custom oligos flanking the targeted sites were used to amplify genomic DNA from pooled edited cells (Supplementary Table 7) using High-Fidelity 2× Master Mix (New England Biolabs). Indel frequencies were quantified by comparing unedited control and knockout cell lines using Inference of CRISPR Edits (ICE)73.
-
bioRxiv - Cancer Biology 2021Quote: ... samples were mixed with 7 μl 5x Ultra II FS buffer and 2 μl Ultra II FS enzyme (New England BioLabs), and incubated 12 minutes at 37 °C followed by 30 minutes at 65 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... and PCR amplified for 7-9 cycles depending on the samples using NEBNext High Fidelity 2× PCR master mix (New England Biolabs). The optimal cycle number was determined empirically each time by qPCR ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were generated by 7-9 rounds of PCR amplification using NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L), purified using SPRIselect reagent kit (Beckman Coulter ...
-
bioRxiv - Physiology 2021Quote: ... 5’ end repair was done using T4 PNK with 2 mM ATP (NEB P0756S). Following RNA purification with Zymo Oligo Clean & Concentrator (D4060) ...
-
bioRxiv - Developmental Biology 2023Quote: ... On-Bead 5’ Decapping reaction was done using NEBuffer 2 buffer (NEB, B7002S ®). Off-Bead Reverse Transcription followed the instructions in SuperScript ® IV Reverse transcriptase kit ...
-
bioRxiv - Neuroscience 2020Quote: ... according to the manufacturer’s recommendations and subjected to ligation (2h at RT) with a pre-adenylated 3’ linker (2µM final) and a truncated T4 ligase (NEB M0373L). Ligated RPFs of 50 – 70 nucleotides (nt ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 µL ligation mix (2 µL 10x T4 ligase buffer, NEB, 1 µL T4 RNA ligase 2, truncated, NEB, 1 µL Ribolock inhibitor) was added and incubated (1 h ...
-
bioRxiv - Cell Biology 2021Quote: ... RHA PCR products were ligated into pAAV p21 vector by Gibson assembly at a ratio vector:inserts of 1:2:2 using T4 DNA ligase (NEB). All constructs were checked by sequencing before transfection into cells ...
-
bioRxiv - Synthetic Biology 2019Quote: All digestions were performed for 1-2h at 37° with REs purchased from NEB, and purified using the Monarch PCR & DNA Cleanup Kit (NEB) ...
-
bioRxiv - Microbiology 2022Quote: ... a custom 3’ adapter (5’-rAppCTGTAGGCACCATCAAT–NH2-3’, NEB, S1315S) was ligated to all RNAs ...
-
bioRxiv - Cell Biology 2019Quote: ... stained with oligo-conjugated WGA at a concentration of 2-5 μg/mL in 1× HBSS with 2000× diluted murine RNase inhibitor (New England Biolabs, M0314L) at 37 °C for 20 min ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μl of 10 mM MnCl2 and 1-2 μl (400-800 units) of λ PP (New England Biolabs, Ipswich, MA). Untreated lysates received 1-2 μl of water in place of λ PP ...
-
bioRxiv - Systems Biology 2021Quote: ... the purified DNAs were annealed using random nonamer primers with a 5′-biotin tag (5′-Biotin-CTACACGACGCTCTTCCGATCTNNNNNNNNN-3′) in the presence of Klenow fragments (3′-5′ exo-, New England Biolabs). Then ...
-
bioRxiv - Cancer Biology 2023Quote: ... Pu TKamplicon (5’-CTGTTTTCATTCTGCCTTTTGACCATAGAGCCCACCGCATCC-3’ and 5’-GCCAACAAAGAAAGCCTCACTACC GGGTAGGGGAGGCG -3) and Gibson Assembly master mix (NEB) following the manufacturer’s guidelines.