Labshake search
Citations for New England Biolabs :
101 - 150 of 2074 citations for 6 fluoro 5 nitroquinoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... 5 µL of nuclease-free water and 5 µL of GA mastermix (NEB) were added and incubated at 40°C for a minimum of 1.5 hours ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2.5 mM G(5’)ppp(5’)G RNA Cap Analogue (New England Biolabs), 4 μg DNA ...
-
bioRxiv - Biochemistry 2019Quote: ... A 3’ DNA adapter (CTATAGTGTCACCTAAATTAATACGACTCACTATAGGG) that contains 5’ phosphate and 3’ spacers was first 5’-adenylated using a 5’-adenylation kit (NEB #E2610-S) at 65°C for 1 h ...
-
bioRxiv - Cancer Biology 2022Quote: ... Ligation of 5’ adaptor required (i) Removal of the 5’ cap using RNA 5’ pyrophosphohydrolase (RppH, New England Biolabs, Ipswich, MA, M0356S) (ii ...
-
bioRxiv - Genomics 2020Quote: ... 2 μl 10 mM dATP and 5 μl Klenow Fragment (3’ −> 5’ exo-) (NEB) for A-tailing at 37°C for 30 min ...
-
bioRxiv - Biochemistry 2020Quote: ... in the presence of m7G(5’)ppp(5’)G RNA Cap Structure Analog (NEB). 5 μg DENV-Luc RNA was electroporated into 2×106 Vero cells ...
-
bioRxiv - Genetics 2022Quote: ... The m7G(5’)ppp(5’)G RNA Cap (New England BioLabs, catalog number S1404L) was used as Cap Analog with 4:1 of Cap Analog:GTP ratio ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 1.5 μl Klenow Fragment (3’->5’ exo-) (NEB, cat#M0212S, 5 U/μl) per amplicon pool reaction ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5’ ends were dephosphorylated using 5 U of Antarctic phosphatase (New England BioLabs/M0289S). A mix containing the RNA sample (~10 pmol) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 μL of a mix containing 5 U of T4 RNA Ligase 2 (NEB), 1 mM ATP ...
-
bioRxiv - Genomics 2024Quote: ... the 5’ end of RNAs were enzymatically modified with RNA 5’ Pyrophosphohydrolase (RppH; NEB) and hydroxyl repair was performed using T4 Polynucleotide Kinase (PNK ...
-
bioRxiv - Microbiology 2024Quote: ... The 3p-v4 oligo was 5′ adenylated using 5′ DNA Adenylation Kit (E2610S, NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... The primer sets used were designed by Primer 6 (PREMIER Biosoft Biolabs) (Appendix Table S2) ...
-
bioRxiv - Biochemistry 2019Quote: ... unlabeled AdoMet was left out and 6 μg of MBP2* protein (NEB) was added to each reaction to increase molecular crowding.
-
bioRxiv - Microbiology 2022Quote: ... the reactions were stopped by adding 2µl of 6× loading dye (NEB) containing 20 mM EDTA and analyzed via agarose gel electrophoresis.
-
bioRxiv - Evolutionary Biology 2020Quote: ... SgRNAs were complexed to 6 μg EnGen Spy Cas9-NLS (NEB #M0646) in an approximately 1:1 molar ratio for 15 min at RT ...
-
bioRxiv - Genetics 2021Quote: ... The extract was bound to 6 ml amylose resin (New England Biolabs) for 1 h batchwise ...
-
bioRxiv - Molecular Biology 2023Quote: ... and TruSeq 6-bp index adaptor ligation by Quick ligase (NEB M2200S), and NEBNext High-Fidelity 2X PCR Master Mix (NEB M0541S) ...
-
bioRxiv - Microbiology 2023Quote: ... the isolated glycoproteins are treated by α-2,3/6/8 neuraminidase (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 µL T4 PNK (NEB), and 1 µL Klenow large fragment (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 μL CutSmart buffer (NEB), and 30 μL of nuclease-free water and incubated for 1 h at 37 °C and 10 min at 80 °C ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 μL HinFI enzyme (NEB), 5 μL ExoI buffer (NEB) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 μL ExoI buffer (NEB), 5 μL CutSmart buffer (NEB) ...
-
bioRxiv - Genetics 2020Quote: ... and SacII (NEB, Figure 5) overnight at 37°C ...
-
bioRxiv - Genomics 2019Quote: ... and 5-mdCTP (NEB #N0365S)) similar to T-WGBS (Lu et al ...
-
bioRxiv - Genetics 2021Quote: ... RNAse H (5 Units, NEB), rSAP (1 Unit ...
-
bioRxiv - Genetics 2020Quote: ... 5 μl CviQI (NEB R0639S), and 5 μl CviAII (NEB R0640S) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 25U 5’ Deadenylase (NEB, #M0331S), 30U RecJ endonuclease (NEB ...
-
bioRxiv - Synthetic Biology 2022Quote: ... coli NEB 5-alpha (NEB) and plated onto medium with the cognate antibiotic ...
-
bioRxiv - Bioengineering 2019Quote: ... 5 U T4 ligase (NEB), and water for a total reaction volume of 20 μl ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 5’ dephosphorylation protocol (NEB #M0289) and T4 DNA ligase protocol (NEB #M0202) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 μl HinFI (NEB, R0155S), 5 μl ExoI buffer (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.5μl 5’ Deadenylase (NEB M0331S), 1μl RecJ endonuclease (NEB M0264S) ...
-
bioRxiv - Molecular Biology 2021Quote: ... coli 5-alpha cells (NEB). Plasmid DNA from multiple independent clones was isolated for each construct using a Zymo Zyppy 96-well plasmid prep kit ...
-
bioRxiv - Biochemistry 2022Quote: ... 5 ng ET SSB (NEB), 4 nM phi29 DNAP in a 100 μl reaction and incubated for 3 h at 30°C ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 5 μL rCutSmart Buffer (NEB), and 1 μL DpnI (NEB ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 nL PEG8000 (50%, NEB) 0.5 nL BSA (20ng/ml ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 nL PEG8000 (50%, NEB), 1.2 nL BSA 20 ng/ml (NEB) ...
-
bioRxiv - Microbiology 2023Quote: ... coli 5-alpha cells (NEB) following manufacturer’s recommendations and selected by plating on LB in the presence of appropriate antibiotics ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 µL RppH (NEB #M0356S). Decapped RNA was cleaned using Zymo Oligo clean and concentrator kit (Zymo Research #D0460 ...
-
bioRxiv - Microbiology 2023Quote: ... and 5’-deadenylase (NEB M0331S) treatments ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 5’ deadenylase (NEB, M0331) for 30min at 30°C followed by column purification (Zymo research ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli NEB 5-alpha (NEB) was used for standard cloning of other plasmids ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 5 U BbsI (NEB, R0539L) and nuclease-free water for a total of 5 µl reaction mix ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli NEB 5-alpha (NEB) and otherwise followed the manufacturers recommended protocol ...
-
bioRxiv - Genetics 2023Quote: ... 5 units of HindIII (NEB), 4.13 µL of H2O ...
-
bioRxiv - Genetics 2023Quote: ... 5 units of HindIII (NEB), and 6.33 uL of purified DNA ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 5 U BsaI-HFv2 (NEB), 250 U T4 DNA ligase (2,000,000 U/ml ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’-decapping (RppH, M0356S; NEB) and 5′-hydroxyl group repair (T4 polynucleotide kinase (M0201L ...
-
bioRxiv - Molecular Biology 2023Quote: ... NcoI- HF (NEB, 5 U) or Rad50/Mre11 (125 nM final tetramer ...