Labshake search
Citations for New England Biolabs :
101 - 150 of 6118 citations for 6 Chloro 2 4 chlorophenyl N N dimethylimidazo 1 2 α pyridine 3 methanamine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
MANF regulates unfolded protein response and neuronal survival through its ER-located receptor IRE1αbioRxiv - Cell Biology 2020Quote: For analysis of protein N-glycosylation PNGase F (P0704S, New England Biolabs) was used and the assay was performed according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: Removal of N-linked glycans and glycosaminoglycans (GAGs) using PNGaseF (NEB #P0704), heparinase II (NEB #P0736) ...
-
bioRxiv - Biochemistry 2021Quote: Peptide-N-glycosidase F (PNGase F) (New England Biolabs Inc., Cat. P0704S) was used for complete removal of N-linked oligosaccharides ...
-
bioRxiv - Microbiology 2023Quote: The N-glycans of ACE2 were removed by PNGase F glycosidase (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 mM MgCl2 and 2 μL (10 U) RNase H (NEB, Cat# M0297S) in order to digest poly(A ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA (400ng) was then ligated the 3’adaptor (5’-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3’) using T4 RNA ligase 2(NEB) for 4 h at 37°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA (400ng) was then ligated the 3′adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′) using T4 RNA ligase 2 (NEB) for 4 h at 37°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... in a total volume of 20 µL containing 10 U of T4 RNA Ligase 1 (NEB, cat n° M0204L), 1X T4 RNA ligase buffer ...
-
bioRxiv - Microbiology 2024Quote: ... the sequence encoding amino acid residues 1 to 35 of the N-terminal end of BVG96_RS17270 (89) was PCR amplified using Q5 polymerase (NEB) and cloned via NEBuilder HiFi DNA Assembly (NEB ...
-
bioRxiv - Biophysics 2019Quote: ... were bound to the beads in the presence of 1 µM DNA oligonucleotide 5’-TCTCCTCCGAAGAAA-3’ (targeting DNA) and 2 µL RNase H (5 units/µL, NEB) were added to the reaction ...
-
bioRxiv - Developmental Biology 2021Quote: ... Pmex-5::PH-GFP-cyk-1(700-1437)::tbb-2 3’UTR in the pCFJ150 backbone [89] was made using HiFi cloning (New England Biolabs). Notably ...
-
bioRxiv - Molecular Biology 2024Quote: ... at 37 °C for 1 h and ligated to a 3′ adaptor sequence using T4 RNA ligase 2 (truncated K227Q, New England Biolabs) at 22 °C for 3 h ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 μl 10x NEBuffer 1 (New England Biolabs), 2 μl 50 mM MnCl2 ...
-
bioRxiv - Plant Biology 2023Quote: ... The up- and downstream flanks were obtained by PCR on gDNA of IPO323 with primer pairs 1&2 and 5&6 (Table S7) respectively using Q5 Hot Start High fidelity DNA polymerase (NEB, Evry, France). The hph was amplified from pCAMBIA0380 with the primers 3 and 4 (Table S7) ...
-
bioRxiv - Immunology 2022Quote: ... N-glycans were enzymatically removed from the underlying peptides with PNGase F (NEB) overnight at 37 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... pGEM-N-SNAPf was first constructed by removing SNAPf from pSNAPf (NEB, N9183S) with AgeI-XhoI and inserting it into the AgeI-XhoI site of pGEM-HE (51) ...
-
bioRxiv - Cell Biology 2020Quote: ... was then cloned at the N-terminus of Atg11 using Gibson Cloning (NEB) to generate 2GFP-Atg11 yCPLAC33 (Li et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... Reaction was set up using ARCA (NEB, S1411L or Trilink, N-7003-5) and N1-Methylpseudouridine-5’-Triphosphate (Trilink ...
-
bioRxiv - Molecular Biology 2023Quote: ... digested O/N at 42°C with 3U β-agarase (New England Biolabs) and again for 2 hrs with 2U β-agarase ...
-
bioRxiv - Cell Biology 2023Quote: ... The Peptide-N-Glycosidase F (PNGase F) enzyme (New England Biolabs, catalog #: P0704L)-treated samples served as a control for unglycosylated α1 subunits ...
-
bioRxiv - Immunology 2023Quote: ... N-glycans were enzymatically removed from the tryptic peptides with PNGase F (NEB) overnight at 37°C ...
-
bioRxiv - Genomics 2020Quote: ... 2 μl 10 mM dATP and 5 μl Klenow Fragment (3’ −> 5’ exo-) (NEB) for A-tailing at 37°C for 30 min ...
-
bioRxiv - Plant Biology 2021Quote: ... for 3 hours at 55°C and M-2 was digested with XhoI (NEB) overnight at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... 3’-adenylation reactions were conducted by adding 5 μL of NEB buffer 2 (NEB), 1 μL 10 mM dATP ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA was ligated with 3′-adenylated adapters using T4 RNA Ligase 2 (NEB #MO351) for 4 hrs at 16°C ...
-
bioRxiv - Microbiology 2023Quote: ... the isolated glycoproteins are treated by α-2,3/6/8 neuraminidase (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 μL of 2% SDS and 2 μL of proteinase K (New England Biolabs) were added and the solution was incubated at 37°C for 1 hour before purification with the Qiagen DNA clean up kit ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2 μl 10X NEBuffer 2 (New England Biolabs) and nuclease-free water (total of 20 μl ...
-
bioRxiv - Bioengineering 2022Quote: ... 1X of a restriction enzyme mix [1/2 EcoRI-HF® (NEB #R3101, 2/5 Nuclease-free water, 1/10 CutSmart Buffer 10X (NEB)] ...
-
bioRxiv - Genetics 2022Quote: ... The resulting monophosphorylated RNAs were ligated to the 3’ adaptor (5’rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’, IDT) using T4 RNA ligase 2 in the presence of 25% PEG8000 (NEB) at 15 °C overnight ...
-
bioRxiv - Cell Biology 2023Quote: ... The small RNAs were then ligated to a 3’ adaptor (5’ rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’; IDT) by T4 RNA ligase 2(NEB). The 5’ adaptor containing 6 nt barcode was ligated using T4 RNA ligase 1 ...
-
bioRxiv - Microbiology 2024Quote: ... Radioactively labelled tRNAs carrying a 2′,3′ cyclic phosphate at the 3′ end was dephosphorylated using T4 polynucleotide kinase (NEB) in 100 mM Tris-HCl pH 6.5 ...
-
bioRxiv - Microbiology 2023Quote: ... 3 μL of 5’ adenylated linkers (Supplementary Table 4) were added (33 pmol/μL) along with 1 μL T4 RNA ligase 2 truncated (New England BioLabs) and incubated at 25 °C for 2.5 hours ...
-
bioRxiv - Developmental Biology 2021Quote: ... pFastBac dual vector containing the sequence for the N-terminally 6xHis-tagged human Naa15 and truncated human Naa10 (residues 1-160) sequences was digested using KpnI-HF (NEB) and XmaI (NEB ...
-
bioRxiv - Biochemistry 2021Quote: The α-(1,2)-Galf-containing N-linked glycans were released from 1 mg Transglucosidase L “Amano” (Amano) by using PNGase F (New England Biolabs) under denaturing conditions ...
-
bioRxiv - Molecular Biology 2020Quote: ... where 200pmol 5’-adenylated,3-dideoxyC DNA adapters (Table 1) were ligated with 400U truncated T4 RNA ligase 2 (NEB M0242) in 1X ATP-free T4 RNA ligase buffer [50mM Tris pH 7.5 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 6 and 4 μL of 6× Gel Loading Dye (B7025S, New England Biolabs) and 1.5 and 1 μL of 2.5 mg/mL EtBr were added ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 μL of GlycoBuffer 2 (NEB Cat # B0701S, 10X), 2 μL of 10% NP-40 (NEB Cat # B0701S ...
-
bioRxiv - Systems Biology 2024Quote: ... 2 µl of NEBuffer 2 (New England Biolabs B7002) and 1 µl of Klenow large fragment DNA polymerase (New England Biolabs M0210 ...
-
bioRxiv - Biochemistry 2020Quote: ... tsetse saliva was treated with peptide-N-glycosidase A (PNGase A, New England Biolabs), which releases all N-linked glycans ...
-
bioRxiv - Cell Biology 2021Quote: ... N-hydroxysuccinimide ester (BG-GLA-NHS) functionalized benzylguanine was purchased from NEB (Cat #S9151S) and freshly reconstituted in DMSO to a final concentration of 83 mM ...
-
bioRxiv - Biochemistry 2022Quote: The standard N-glycoprotein bovine pancreatic ribonuclease B (RNase B, New England Biolabs, USA) was used as a substrate to measure NGLY1 activity ...
-
bioRxiv - Molecular Biology 2022Quote: Removal of N-linked glycosylation was performed using PNGaseF (New England Biolabs, Ipswich, USA) at a concentration of 125 U/μg protein ...
-
bioRxiv - Biochemistry 2022Quote: ... The N-terminal deletions were made using the HiFi DNA cloning kit from NEB to excise portions of the N-terminus of the gene ...
-
bioRxiv - Cancer Biology 2019Quote: ... N-linked glycans were removed using endoglycosidase H (Endo Hf, New England BioLabs, P0703). De-glycosylated VISTA protein was separated from Endo Hf via additional nickel affinity chromatography ...
-
bioRxiv - Microbiology 2021Quote: ... removal of N-glycans was performed by digestion with PNGaseF (New England Biolabs, P0704S), according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... Deglycosylation was performed with peptide-N-glycosidase F (PNGase F; New England Biolabs, USA) following the manufacturer’s instructions [28] ...
-
bioRxiv - Cell Biology 2022Quote: ... and ligated into pcDNA5/FRT/TO-N-FLAG-BirA* using Quick Ligation Kit (NEB). Top10 competent E ...
-
bioRxiv - Genomics 2020Quote: ... add 2 μl 10 mM dATP and 5 μl Klenow Fragment (3’ −> 5’ exo-) (NEB) to digest the unligated DNA fragments at 37°C for 40 min ...
-
bioRxiv - Molecular Biology 2020Quote: 3’ linker ligation (1x PNK buffer, 800 u T4 RNA ligase 2 truncated KQ (NEB), 80 u RNaseOUT ...