Labshake search
Citations for New England Biolabs :
101 - 150 of 4087 citations for 4R 5S 2 5 Fluoropyridin 2 yl 4 5 diphenyl 4 5 dihydrooxazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Biophysics 2024Quote: Purified RNA 3xUCUCU (10 pmol) was first 5’-end dephosphorylated by 5 units of antarctic phosphatase (NEB, 5 U/µL) in antarctic phosphatase buffer (NEB ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 µg DNA was digested with 5 µl RNase H (NEB, M0297), 3 µl Hind III (Fisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... m7G(5’)ppp(5’) A RNA Cap Structure Analog (New England Biolabs) was included in the transcription reaction ...
-
bioRxiv - Microbiology 2021Quote: ... T5 exonuclease diluted 1:5 with 5× reaction buffer (New England BioLabs) (0.01 units/μl) ...
-
bioRxiv - Genomics 2021Quote: ... (iii) 5′ de-capping with RNA 5′ pyrophosphohydrolase (NEB, Ipswich, MA; M0356), (iv ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 5 µg of DNA were nicked with 5 units of Nb.BbvCI (NEB) in CutSmart buffer (NEB ...
-
bioRxiv - Genomics 2022Quote: ... (iii) 5′ de-capping with RNA 5′ pyrophosphohydrolase (NEB, Ipswich, MA; M0356), (iv ...
-
bioRxiv - Molecular Biology 2024Quote: ... ribonucleotides (6 mM ATP, 5 mM CTP, 5 mM GTP; NEB®), 5 mM N1-methylpseudouridine-5’-triphosphate (TriLink® BioTechnologies ...
-
bioRxiv - Microbiology 2021Quote: ... and was then installed with 5’cap (Vaccinia Capping System, NEB, USA; Cap 2’-O-methyltransferase, NEB, USA) and 3’ Poly(A ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA (5 μg) was ligated to the RNA 3’ adaptor using T4 RNA Ligase 2 - truncated (NEB), in the presence of RNase Inhibitor (NEB) ...
-
bioRxiv - Microbiology 2022Quote: ... poly(A) RNA (2-5 ng) was converted to cDNA using the Protoscript II kit (New England Biolabs) and a supplied mix of random hexamer and d(T)23VN primers ...
-
bioRxiv - Microbiology 2024Quote: ... the DNA adenylated oligonucleotide adenylate intermediate was de-adenylated (RNA sample, NEB Buffer 2, and 5’-deadenylase (NEB); incubation at 30 °C for 1 h ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 units Esp3I (NEB), 100 units T4 DNA ligase (NEB) ...
-
bioRxiv - Systems Biology 2021Quote: ... coli (NEB 5-alpha) and plated on L-medium [27] with 100 µg/mL ampicillin ...
-
bioRxiv - Genetics 2023Quote: ... 5 U StuI (NEB), CutSmart buffer (NEB) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 5 U BbsI (NEB), 250 U T4 DNA ligase in 1X T4 ligase buffer with the remainder nuclease-free water into a 5 µL total reaction ...
-
bioRxiv - Zoology 2023Quote: ... coli (NEB 5-alpha). We injected donor plasmids (20 ng/µl ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... coli (NEB 5-alpha) were used.
-
bioRxiv - Evolutionary Biology 2023Quote: ... coli (NEB 5-alpha) for bacterial transformation ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 µg BSA (NEB), 9 mM DTT ...
-
bioRxiv - Molecular Biology 2023Quote: ... RecBCD (NEB, 5 U), NcoI- HF (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5’ deadenylase enzyme (NEB) and incubated at RT overnight ...
-
bioRxiv - Systems Biology 2020Quote: ... we first phosphorylated the 5’ ends of each probe set by combining 4 μL of the pooled oligos with 1 μL T4 PNK (NEB), 20 μL T7 DNA ligase reaction buffer (NEB) ...
-
bioRxiv - Bioengineering 2022Quote: ... the two primers which contain the gRNA and have 4 nt overhang at 5’-end were annealed (3) the annealing product was ligated with PaqC I (New England Biolabs)-digested pMM002P or pMM005 ...
-
bioRxiv - Biochemistry 2023Quote: ... The duplex hRNase 4 cleavage products (5′ fragments of the RNA) were enriched using Hydrophilic Streptavidin Magnetic Beads (New England Biolabs). The beads were washed twice by a high salt buffer (5 mM Tris HCl ...
-
bioRxiv - Neuroscience 2024Quote: ... slides were rinsed three times with deionized water for 5 minutes and incubated in 1x Terminal Transferase (TdT) buffer containing 1X buffer 4 (NEB) and 2.5 μM CoCL2 for 10 minutes at room temperature in a humid chamber ...
-
An alternatively spliced TREM2 isoform lacking the ligand binding domain is expressed in human brainbioRxiv - Molecular Biology 2022Quote: The cDNA samples from the anterior cingulate samples were amplified using primers corresponding to TREM2 exon 1 (5’-CCTGACATGCCTGATCCTCT-3’) and exon 5 (5’-GTGTTCTTACCACCTCCCC-3’) with Q5 high-fidelity hot-start polymerase (NEB # M0493L). Thermocylcing parameters were as follows ...
-
bioRxiv - Cancer Biology 2022Quote: ... The genomic DNA was subjected to a 5-hmC-specific enrichment with EpiMark 5-hmC and 5-mC analysis kit (New England Biolabs, USA). The processed DNA samples were analyzed with qPCR using loci-specific primers (Sf 4) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Gels were sealed in a plastic bag and hybridized at 37 °C overnight with a 5′-(CCCTAA)5−3′ telomeric oligonucleotide probe 5′-end-labeled with T4 polynucleotide kinase (NEB M0201S) and [γ-32P]ATP (PerkinElmer BLU502A) ...
-
bioRxiv - Cancer Biology 2024Quote: ... After signal detection membranes were stripped and re-hybridized overnight at 50 °C with oligonucleotides detecting β-actin (5’-GTGAGGATCTTCATGAGGTAGTCAGTCAGGT-3’) and U6 (5’-GGAACGCTTCACGAATTTGCGT-3’) 5’-end labeled with T4 polynucleotide kinase (New England Biolabs) and [γ-32P]ATP ...
-
bioRxiv - Molecular Biology 2021Quote: ... and to a 5’ adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC) with T4 RNA ligase I (NEB). The resultant RNA was reverse-transcribed to cDNA with Superscript III (Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5’ RNA ligation was performed using 0.5 μl 5’ SR Adapater (NEB-kit) instead of the 5P RNA oligo.
-
bioRxiv - Microbiology 2022Quote: ... with the addition of an m7G(5⍰)ppp(5⍰])G RNA cap (NEB). Transcription was carried out at 42°C for 2 hours (h ...
-
bioRxiv - Genomics 2022Quote: ... and followed by a 5′ decapping with RNA 5′ pyrophosphohydrolase (RppH, NEB, M0356S). The 5′ end was phosphorylated using T4 polynucleotide kinase (NEB ...
-
bioRxiv - Neuroscience 2022Quote: ... and the m7G(5’)ppp(5’)G RNA Cap Structure Analog (#S1411, NEB) kits ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 µL of nuclease-free water and 5 µL of GA mastermix (NEB) were added and incubated at 40°C for a minimum of 1.5 hours ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2.5 mM G(5’)ppp(5’)G RNA Cap Analogue (New England Biolabs), 4 μg DNA ...
-
bioRxiv - Systems Biology 2024Quote: ... and 3 μL of Klenow 3’ to 5’ exo (5 U/μL, NEB), and samples were incubated in a thermocycler at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 mM MgCl2 and 4 units of RNase Inhibitor Murine (NEB, M0314). After 30 min at room temperature ...
-
bioRxiv - Cancer Biology 2022Quote: ... Ligation of 5’ adaptor required (i) Removal of the 5’ cap using RNA 5’ pyrophosphohydrolase (RppH, New England Biolabs, Ipswich, MA, M0356S) (ii ...
-
bioRxiv - Microbiology 2021Quote: ... 5 mM MgCl2, 10% Glycerol, 0.05% NP-40, 2 mM DTT, 10 mM Ribonucleoside-Vanadyl complex [New England Biolabs, MA USA] ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA (400ng) was then ligated the 3’adaptor (5’-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3’) using T4 RNA ligase 2(NEB) for 4 h at 37°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA (400ng) was then ligated the 3′adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′) using T4 RNA ligase 2 (NEB) for 4 h at 37°C ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and 5 µl of CutSmart buffer and 2 µl of EcoRI-HF® (New England Biolabs, catalog no. R3101) were added before incubation for 6 h at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... DNA oligonucleotides (Supplementary Table 2) were radiolabeled at the 5’ end by T4 Polynucleotide kinase (PNK) (New England Biolabs) treatment and [γ-32P] (PerkinElmer ...
-
bioRxiv - Genomics 2022Quote: ... then A-tailed by incubating for 1 h at 37°C with 200 μM dATP and 0.2 U/μL Klenow fragment (3’-5’ exo-) in NEBuffer 2 (NEB), then Illumina PE adapter was added by incubating overnight at 20°C with 15 μM PE adapter and 2000 U T4 DNA ligase in ligase buffer ...
-
bioRxiv - Genetics 2022Quote: ... 1 µL of extracted genomic DNAs and 5 µL of 2× Hot Start High Fidelity Q5 Master Mix (NEB). PCR reactions were carried out under the following condition ...
-
bioRxiv - Microbiology 2024Quote: ... The RT RNA sample (5 μL) was amplified using the LongAmp Taq 2× Master Mix (NEB, Ipswich, MA, USA) with IVT Nanopore T7 Fw and IVT Nanopore T7 Rv primers (Supplementary Table 5) ...
-
bioRxiv - Microbiology 2024Quote: ... Next, the DNA adenylated oligonucleotide adenylate intermediate was de-adenylated (RNA sample, NEB Buffer 2, and 5’-deadenylase (NEB); incubation at 30 °C for 1 h ...