Labshake search
Citations for New England Biolabs :
101 - 150 of 6052 citations for 3 Methyl 1 6 naphthyridine 2 carboximidamide hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... α1- 3,4,6), 10 U β-galactosidase (P0726S, β1-3) and 8 U β-galactosidase (P0746S, β1-3,4) (all from New England BioLabs, USA). All reactions were performed in a final volume of 10 μl in 50 mM sodium acetate buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... Products were then ligated to 3’ adaptor (/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/) by T4 RNA ligase 2(NEB) and 5’ adaptor (rGrUrUrCrArGrArGrUrUrCrUrArCrArGrUrCrCr-GrArCrGrArUrCrNrNrNrCrGrArNrNrNrUrArCrNrNrN ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Vcan exon 2 and exon 3 were amplified using Phusion Taq (NEB, catalog no. F530L) (see SI) ...
-
bioRxiv - Microbiology 2022Quote: ... 2 mM 3’-O-Me-m 7G(5’)ppp(5’)G cap structure analog (NEB S1411S), 0.5 mM GTP ...
-
bioRxiv - Biochemistry 2023Quote: ... The tRNA 2’-3’ cyclic phosphate was removed by treatment with T4 PNK (New England Biolabs) following the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... and ligated to the 3′ adapter by incubating with T4 RNA ligase 2 truncated mutant (NEB) and 1 µg of pre-adenylated adapter (5′rAppCTGTAGGCACCATCAAT/3ddc ...
-
bioRxiv - Biochemistry 2024Quote: ... the RNA was ligated to the 3′ adaptor tRNA using T4 RNA ligase 2 (NEB, M0351L) for 2 h at 37°C ...
-
bioRxiv - Genetics 2020Quote: ... A 6 µL mixture containing 2 µL of 40 µM Spy Cas9 NLS protein (New England Biolabs, MA, USA), 200 ng each of five sgRNAs (in 2 µL ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 1 μl of 10mM dATP and 3 μl of 5 U/μl Klenow fragment 3’ -> 5’ exo- (NEB M0212) in the thermocycler with the following program ...
-
bioRxiv - Genomics 2021Quote: ... EM-seq libraries from both laboratories were prepared using the NEBNext Enzymatic Methyl-seq (E7120, NEB) kit following manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... Libraries were prepared from 200 ng DNA using the NEB Enzymatic Methyl-Seq kit (NEB #E7120) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: ... a sequencing library was prepared using NEBNext® Enzymatic Methyl-seq Kit (NEB; catalog number E7120S). Library sequencing was performed using NextSeq 2000 (Illumina ...
-
bioRxiv - Genomics 2024Quote: ... and final library amplification were performed using the NEBNext Enzymatic Methyl-seq Kit (New England BioLabs) for WGEM-seq libraries ...
-
bioRxiv - Neuroscience 2024Quote: Libraries were generated using the Enzymatic Methyl-seq kit for Illumina (#E7120, New England Biolabs, U.S.A.). After enzymatic shearing for 25 min at 37°C with the NEBNext UltraShear enzyme and buffer ...
-
bioRxiv - Cancer Biology 2021Quote: ... ΔN1/2/3 and ΔDAD mutants were generated by Q5® Site-Directed Mutagenesis Kit (NEB, E0554S) with HOXB13 WT or NCOR1 WT as a template ...
-
bioRxiv - Microbiology 2022Quote: ... 23 nt RNA (5’-GAAUCUAUACAUAAAGACCAGGC-3’) was capped with vaccinia capping enzyme and 2’-O-methyltransferase (NEB) and radiolabelled with [α 32P]-GTP ...
-
bioRxiv - Immunology 2020Quote: ... (2) and (3) was synthesized through HiScribe™ T7 ARCA mRNA Kit (with tailing) (New England Biolabs). All the mRNA products were concentrated and purified via EZ-10 Spin Column RNA Cleanup & Concentration Kit (Bio Basic Inc.) ...
-
bioRxiv - Molecular Biology 2023Quote: ... the 3’adapter was ligated to the dephosphorylated RNA using T4 RNA ligase 2 KQ (NEB, M0373L) at 25°C for 1h ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA 3′-ends were dephosphorylated in a 10 µL reaction with 2 µL T4 PNK (NEB #M0201S) 1 µL of FastAP Thermosensitive Alkaline Phosphatase (ThermoFisher #EF0651) ...
-
bioRxiv - Molecular Biology 2023Quote: RNA 3′-ends were dephosphorylated in a 10 µL reaction with 2 µL T4 PNK (NEB; #M0201S) 1 µL of FastAP Thermosensitive Alkaline Phosphatase (ThermoFisher #EF0651) ...
-
bioRxiv - Molecular Biology 2022Quote: 3’ linker ligation (1x PNK buffer, 800 U T4 RNA ligase 2 truncated KQ (NEB, Cat#M0373L), 80 U RNaseOUT ...
-
Atypical epigenetic and small RNA control of transposons in clonally reproducing Spirodela polyrhizabioRxiv - Plant Biology 2024Quote: ... were ligated to 3′ barcoded DNA adapters using truncated T4 RNA ligase 2 (New England Biolabs, #M0373). These fragments were separated in an 12% denaturing polyacrylamide-urea gel ...
-
bioRxiv - Genomics 2024Quote: ... along with a 4.8uL 3:2 master mix of T4 ligase buffer:T4 ligase (New England Biosciences, NEB) and 9.4uL of nuclei buffer with BSA (NBB ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μl 1M MgCl2 and 2 μl of 1 U/μl Xrn1 (M0338, NEB) were added after RNase H digest ...
-
bioRxiv - Bioengineering 2024Quote: ... a denaturing purification using 6M guanidium hydrochloride was done using Ni-NTA spin columns (NEB, S1427). Column elution was concentrated using an Amicon 30 kDa filter (Millipore Sigma ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were fixed in 1:3 glacial acetic acid:methanol (Biolabs-chemicals) solution and the G-banding karyotype was determined ...
-
bioRxiv - Molecular Biology 2024Quote: ... steps 1–3: GELase was replaced by β-agarase I (NEB). The reaction (1 U per plug ...
-
bioRxiv - Molecular Biology 2020Quote: ... Ribodepleted RNA were then ligated to 10 pmol of a biotinylated 3’ adapter, (3’-Adap TAIL-seq, Supplementary Table 7) using 10 units of T4 RNA ligase 1 (NEB) in a final volume of 10 μl for one h at 37°C ...
-
bioRxiv - Neuroscience 2020Quote: ... FP: 5’-AGCAAGGCTAGCCAAGACAAGTTTGTAC-3’ and RP: 5’-ACTCACGGGCCCTAGTGGGCAGATCTT-3’ and cloned between Nhe-1 and Apa1 (NEB, Ipswich, MA, USA) sites in mec4p::Lamp-1::GFP.
-
bioRxiv - Microbiology 2023Quote: ... the gRNA cassette carrying the human U6 promoter and the invariant scaffold sgRNA sequence was inserted into the HIV-1 NL4-3 and HIV-1 CH077 pro-viral DNA between separated Nef and 3’LTR region using homologous recombination (NEB builder Hifi DNA assembly mastermix ...
-
bioRxiv - Genetics 2024Quote: RNP was complexed by addition of 1 μl of 10 uM Cas9 with 3 μl of 10 uM gRNA in 3 μl NebBuffer r3.1 (NEB B6003S) and 20 μl DNAse/RNase free water ...
-
bioRxiv - Cell Biology 2024Quote: ... FP: 5’-AGCAAGGCTAGCCAAGACAAGTTTGTAC-3’ and RP: 5’-ACTCACGGGCCCTAGTGGGCAGATCTT-3’ and cloned between Nhe-1 and Apa1 (NEB, Ipswich, MA, USA) sites in TTpl503 [mec4p::Lamp-1::GFP]
-
bioRxiv - Molecular Biology 2020Quote: ... 2 μl 10x NEBuffer 1 (New England Biolabs), 2 μl 50 mM MnCl2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 15 µL 10x T4 ligase buffer, 3 µL 50 mg/mL BSA, 1.5 µL 2000U/µL T4 ligase, NEB, 6 µL BLISS adapter pairs). For removal of excess adapters ...
-
bioRxiv - Genomics 2024Quote: ... Samples were then rinsed with 2X SSC before incubating with a blocking buffer (10% BSA, 3% v/v 6% v/v murine RNase inhibitor [NEB, M0314L] in 2X SSC) for 30 minutes ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μl 10 mM dNTPs and 1 μl Bst 2 WarmStart DNA polymerase (NEB M0538S) was added and sample incubated 30 min at 65°C before precipitation with 12.5 μl 10 M NH4OAc ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 ml of virus was incubated with 1 ml DNase I (NEB, 2 units/ml), 4 µL DNase I buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 μl of 10 mM dATP and 3 μl of 5 U/μl of Klenow fragment (3′→ 5′ exo (-)) (NEB, M0212) were added and the sample was incubated for 30 min at 37 °C followed by a deactivation step at 65 °C for 20 min ...
-
An alternatively spliced TREM2 isoform lacking the ligand binding domain is expressed in human brainbioRxiv - Molecular Biology 2022Quote: The cDNA samples from the anterior cingulate samples were amplified using primers corresponding to TREM2 exon 1 (5’-CCTGACATGCCTGATCCTCT-3’) and exon 5 (5’-GTGTTCTTACCACCTCCCC-3’) with Q5 high-fidelity hot-start polymerase (NEB # M0493L). Thermocylcing parameters were as follows ...
-
bioRxiv - Developmental Biology 2023Quote: ... the coding sequence of alg-1 was amplified from genomic DNA using PCR and primers 5’- acaaggacgacgacgacaagatggaagaccaatggttgct-3’ and 3’- cagttggaattctacgaatgttaagcaaagtacatgacgttgttggc-5’ and the coding sequence of mKate::3xFLAG was amplified from a plasmid containing mKate::3xFLAG using PCR and primers 5’-cggcatcgacgacgacgacgatggtttccgagttgatcaagg-3’ and 3’- cttgtcgtcgtcgtccttgtagtcgatAtcgtggtccttgtagtcaccgtcgtggtccttgtagtccttacgatgtccgagcttgg-5’ and the vector containing rgef-1p and unc-54 3’UTR was amplified from plasmid rgef-1p::aak-2::unc-54 3’UTR using PCR and primers 5’-cattcgtagaattccaactgagc-3’ and 3’-cgtcgtcgtcgtcgatgc-5’ were used to generate rgef-1p::mKate::3xFLAG::alg-1 by using Gibson assembly (NEB E2611). To generate a DNA plasmid containing rgef-1p::mKate::3xFLAG::alg-2 ...
-
bioRxiv - Neuroscience 2023Quote: ... a 3′ RNA adapter with a phosphate on its 5’ (5’- /5Phos/r(N:25252525)r(N:25252525)r(N:25252525)rUrGrGrArArUrUrCrUrCrGrGrGrUrGrCrC rArArGrG/3SpC3/-3’) end was ligated to RNA 3’ ends using T4 RNA ligase 1 (NEB, M0437) at 25 °C for 75 min (with gentle agitation every 10 min) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 6 and 4 μL of 6× Gel Loading Dye (B7025S, New England Biolabs) and 1.5 and 1 μL of 2.5 mg/mL EtBr were added ...
-
bioRxiv - Bioengineering 2022Quote: ... 1X of a restriction enzyme mix [1/2 EcoRI-HF® (NEB #R3101, 2/5 Nuclease-free water, 1/10 CutSmart Buffer 10X (NEB)] ...
-
bioRxiv - Genomics 2022Quote: The crRNAs and tracRNA (see Extended Table 3) were mixed 1:1 to 1 μM in supplied buffer 3.1 (NEB) with 0.2 U/μl RNaseOUT™ (Invitrogen) ...
-
bioRxiv - Biochemistry 2020Quote: ... Cross-links were reversed from eluted chromatin by adding 6 μL of 5 M NaCl and 2 μL Proteinase K (NEB; P8107S) and incubation overnight at 65°C ...
-
bioRxiv - Microbiology 2021Quote: ... 3 µL NEB Ultra II End-prep Enzyme Mix and 2 µL NEBNext FFPE DNA Repair Mix (NEB) were added to the DNA (final volume 60 µL) ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA (5 μg) was ligated to the RNA 3’ adaptor using T4 RNA Ligase 2 - truncated (NEB), in the presence of RNase Inhibitor (NEB) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Genomic DNA was digested for 2-3 hours at 37°C with StuI or SphI restriction enzymes (NEB), as indicated in the figure legends ...
-
bioRxiv - Genomics 2023Quote: ... with the ligation of 3′-small RNA Tru-Seq adapter using the truncated T4 RNA Ligase 2 (NEB). 45-150 nt capped small RNAs were recovered on 15% Urea-TBE gel (Novex ...
-
bioRxiv - Genomics 2022Quote: ... The DNA was digested with MluCI (5µl Cut smart buffer, 1.5-2 µg DNA, 3 µl MluCI (New England Biolabs Inc. (NEB), and water to make up 49 µl ...