Labshake search
Citations for New England Biolabs :
101 - 150 of 4949 citations for 1 6 Chloropyridazin 3 yl piperidine 4 carboxamide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... The 3′ adapter (sequence: AGATCG-GAAGAGCACACGTCTGAACTC) was ligated using T4 RNA Ligase 1 (NEB, M0204L) and purified nascent RNA using streptavidin beads (NEB ...
-
bioRxiv - Biochemistry 2024Quote: ... In short 5’-phosphorylated and 3’-OH RNA was circularized with RNA ligase 1 (NEB) followed by denaturing PAGE purification as described above ...
-
bioRxiv - Systems Biology 2024Quote: ... and NEBNext Multiplex Oligos for Illumina Index Primers Set 1 and 3 (NEB E7335S, E7710S) and PCR-amplified for 15 cycles ...
-
bioRxiv - Cancer Biology 2021Quote: ... Digests with 6 x loading dye (NEB) were run on a 1 % agarose gel at 100 V for 1 h ...
-
bioRxiv - Molecular Biology 2022Quote: ... with 6 μl CutSmart Buffer (NEB, B7204) in a total volume of 60 μl for 3 hours at 37 °C ...
-
bioRxiv - Microbiology 2020Quote: ... and 6 U Bst3.0 DNA polymerase (NEB) in total 15 μl reaction volume ...
-
bioRxiv - Microbiology 2020Quote: ... 6 mM MgSO4 (NEB, final 8mM Mg2+), 1.4 mM each dNTP (Enzynomics) ...
-
A rapid, highly sensitive and open-access SARS-CoV-2 detection assay for laboratory and home testingbioRxiv - Molecular Biology 2021Quote: ... 6 mM MgSO4 (100 mM stock, NEB), 0.32 U/μl NEB Bst 2.0 polymerase ...
-
bioRxiv - Cancer Biology 2021Quote: ... Digest with 6 x loading dye (NEB) was run on a 1 % agarose gel at 100 V for 1 h ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 6 U of Heparinase I (NEB) was added to the first strand cDNA synthesis mix ...
-
bioRxiv - Neuroscience 2021Quote: ... 6 μl BST LF polymerase (NEB M0275L), and 36 μl DEPC-treated H2O ...
-
bioRxiv - Bioengineering 2024Quote: ... 6 mM Magnesium Sulfate (MgSO4 – NEB #B1003), 1.4 mM deoxynucleotide (dNTP ...
-
bioRxiv - Biochemistry 2023Quote: ... followed by PNGase A (NEB; pH 6). The released N-glycans were purified using initially a cation exchange material (Dowex AG50 H+ form ...
-
bioRxiv - Plant Biology 2024Quote: ... 6 µg of the commercial EngenCas9 (NEB) with 2 µg of the freshly synthetized SgRNA1 obtained with the HiScribe™ T7 High Yield RNA Synthesis Kit (NEB) ...
-
bioRxiv - Biochemistry 2024Quote: ... mixed with 6× DNA loading dye (NEB), and separated by agarose gel electrophoresis as in the DNA cleavage assays ...
-
bioRxiv - Genomics 2022Quote: To digest linear DNA 1 μg of DNA sample was incubated in 50 μl with 1× NEBuffer 4 (NEB), 1mM ATP (NEB ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Molecular Biology 2020Quote: ... was linked to the free hydroxyl group at the 3’-end of transcripts (1 □g of total RNA) by T4 RNA ligase 1 (NEB M0204) in the presence of 15% (w/v ...
-
bioRxiv - Genetics 2021Quote: ... EagI/KpnI-digested ORFs were ligated into the EagI/KpnI-digested pUASTattB vector backbone using a 6:1 insert:vector molar ratio and T4 DNA ligase (M0202S, NEB) in a thermocycler overnight (∼16 hr) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and subsequently mixed at a 6:1 ratio with the digested backbone in reactions containing T4 DNA ligase (NEB).
-
bioRxiv - Biophysics 2024Quote: ... 800 μL of 2 M MgCl2 and 1.6 mL 1 M CaCl2 were added to the lysed cells along with 2.5 μL DNase (New England Biolabs) and OmniCleave endonuclease (Biosearch Technology ...
-
bioRxiv - Microbiology 2020Quote: ... 3 mM MgCl2 (NEB), 0.24 mg.ml−1 BSA (Fermentas) ...
-
bioRxiv - Neuroscience 2021Quote: ... and 3 (NEB #E7710) were used to create unique identifiers for each cDNA library sample ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3 µL MNase (NEB) was added to a clarified K562 lysate from ∼5 M cells and digested for 30 minutes at 37 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3’ NotI (NEB) before being tested by sequencing (Macrogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’-hydroxyl (5’HO-RNA30-FAM-3’) or 5’-Gppp (5’Gppp-RNA30-FAM-3’) in 1x NEBuffer 3 (NEB; B7003), in 20% denaturing polyacrylamide gels ...
-
bioRxiv - Developmental Biology 2023Quote: ... rgef-1p and gfp were inserted into a vector containing the sequence rab-7 amplified using PCR and primers 5’-atgtcgggaaccagaaagaa-3’ and 3’-aagcttatcgataccgtcgac-5’ to create rgef-1p::gfp::rab-7::rab-7 3’UTR using Gibson assembly (NEB E2611). A full list of reagents and resources can be found in table S2.
-
bioRxiv - Cancer Biology 2021Quote: ... or a polyclonal rabbit antibody against cleaved casp-3 (1:100; New England Biolabs, Frankfurt, Germany), followed by a biotinylated goat anti-rabbit secondary antibody (Abcam ...
-
bioRxiv - Genomics 2020Quote: ... 1 μL of 10 mM dATP and 15 units of Klenow 3’ → 5’ exo- (NEB M0212L) was added to blunted ends and incubated at 37°C for 30 minutes ...
-
bioRxiv - Cancer Biology 2020Quote: ... Positive control slides were treated with 3 U/mL DNase-1 (New England Biolabs, Cat. M0303) for 10 minutes at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... Pre-adenylated L3-1R-App 3’ adaptors were ligated using T4 RNA ligase 1 (M0204, NEB) for 75 min at 25°C ...
-
bioRxiv - Microbiology 2024Quote: ... 1 µL of 10% SDS and 3 µL of proteinase K (New England Biolabs, Ipswich, MA) were added to the suspension ...
-
bioRxiv - Molecular Biology 2024Quote: ... Tat or 3’ LTR by ligation using 1 U of T4 DNA ligase (New England Biolabs) as per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... and A-tailed by mixing 3 µl PCR product + 1 µl 10x Thermopol buffer (NEB M0267S) + 0.2 µl ATP + 1 µl Taq polymerase and incubating the reaction at 70°C for 30 minutes ...
-
bioRxiv - Microbiology 2023Quote: Verified amplicons were combined with the pMV306H integrative vector backbone at a ratio of 1:1 v/v and allowed to ligate overnight at 4°C with T4 DNA ligase (NEB). Ligation products were subsequently transformed into chemically competent DH5ɑ E.coli ...
-
bioRxiv - Neuroscience 2022Quote: 4 µl procainamide-labeled glycans were combined with 1 µl 10x sodium acetate – Ca2+ buffer (Glycobuffer 1, New England Biolabs), 1 µl 10x BSA (diluted 1:10 with Milli-Q water from a 100X stock ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plasmid expressing EBFP2-14-3-3 theta was created using HiFi Cloning (NEB) of 14-3-3 theta into pEBFP2-C1 (Addgene plasmid #54665) ...
-
bioRxiv - Immunology 2021Quote: ... 3’ loxP site and 3’ arm of homology) was linearized with NotI (NEB) and recombineered into RP24-227B3 BAC clone that was transformed into SW102 strain by electrophoration (186 ohms ...
-
bioRxiv - Systems Biology 2024Quote: ... and 3 μL of Klenow 3’ to 5’ exo (5 U/μL, NEB), and samples were incubated in a thermocycler at 37°C for 30 min ...
-
bioRxiv - Microbiology 2020Quote: ... 6 µg of DNA was used for MmeI digestion in 200 µL (6 µg gDNA, 6 µL MmeI (2000 U/mL, NEB), 0.5 µL 32 mM S-adenosylmethionine ...
-
bioRxiv - Synthetic Biology 2022Quote: ... A fraction (6 μL) of the eluate was mixed with an equal volume of 6× purple gel loading dye (NEB) and loaded in 1% agarose gel with ethidium bromide ...
-
bioRxiv - Immunology 2023Quote: ... was biotinylated with sulfosuccinimidyl-6-[biotinamido]-6-hexanamido hexanoate (sulfo-NHS-LC-LC biotin; ThermoScientific) and coupled to streptavidin beads (New England Biolabs). Patient samples were incubated with RBD-coupled beads and excess sera washed off with PBS (Sigma) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 6 μl 10mM ATP (New England Biolabs). Linear DNA was then digested by 30 minute incubation at 37°C ...
-
bioRxiv - Biochemistry 2021Quote: ... and 6 μM of random hexamer primer (NEB). cDNA was amplified with Taq DNA polymerase (NEB ...
-
bioRxiv - Genetics 2020Quote: ... 6 μl 20 mg/ml BSA (NEB B9000S), and 5 μl of 400 U/μl T4 ligase (NEB M0202S/L) ...
-
bioRxiv - Microbiology 2022Quote: ... 6 U Bst 2.0 WarmStart DNA polymerase (NEB), and 2.25 U WarmStart® RTx Reverse Transcriptase (NEB) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 6 U/ml Thermolabile proteinase K (NEB). The barcoded PAAm beads were prepared for encapsulation as previously described (Zilionis et al. ...
-
bioRxiv - Microbiology 2024Quote: ... 6 μl of 50% PEG 8000 (NEB B1004A), 40 units of Ribolock RNase inhibitor EO0382)] ...
-
bioRxiv - Microbiology 2023Quote: ... 6 µL of Proteinase K (New England Biolabs) was added to the cell resuspension ...
-
bioRxiv - Bioengineering 2024Quote: ... and 6 μL Quick CIP (New England Biolabs), and left to react for 3 h at 37 °C ...