Labshake search
Citations for New England Biolabs :
1401 - 1450 of 9821 citations for Mouse Relaxin 3 RLN3 CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: Living ovaries were incubated at room temperature in SNAP solution containing 3 μM SNAP- Cell TMR-Star or SNAP-Cell 647SiR (New England BioLabs, S9105S and S9102S), 10% FCS and 0,2 mg/ml Insulin in Schneider’s medium ...
-
bioRxiv - Microbiology 2021Quote: ... The digested DNA (4 ml in total) was split into 4 aliquots and diluted in 8 ml ligation buffer (1X ligation buffer NEB 3 (without ATP), 1 mM ATP ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 1 µl murine RNase inhibitor per sample and 3 µl were added to each sample together with 2 µl truncated T4 polynucleotide kinase (#M0201, NEB; Frankfurt/Main, Germany). Samples were incubated for 2 h at 37°C and the enzyme was deactivated after the reaction by 10 min incubation at 75°C ...
-
bioRxiv - Neuroscience 2019Quote: ... We designed custom adaptors (Table S5) which were directly ligated to the 3’ ends of RNA using RNA ligase 1 (NEB Cat. No. M0437) and truncated RNA ligase KQ (NEB M0373) ...
-
bioRxiv - Plant Biology 2021Quote: ... Detection of editing in the EBE region of CsLOB1 promoter was performed by amplifying the target region (primers in Supplementary Table 3) with high fidelity DNA polymerase Q5 (New England Biolabs, Ipswich, MA, USA), followed by cloning of PCR products and sequencing.
-
bioRxiv - Molecular Biology 2023Quote: ... digoxigenin-11-ddUTP was added to the 3’ end of the digested fragments using terminal transferase enzyme (New England Biolabs, Ipswich, MA, USA).
-
bioRxiv - Genomics 2023Quote: ... This 17 µl of DNA solution was incubated with 3 µl digestion mixture containing 1 µl BciVI (New England Biolabs, cat. no. R0596S) and 2 µl CutSmart buffer (New England Biolabs ...
-
bioRxiv - Physiology 2024Quote: ... and PCR was performed with Flag F (caaggacgacgatgacaaagtc) + 3’OUTR (CAGAGCCAACAACGTGAGGT) primers using Q5® High-Fidelity DNA Polymerase (New England Biolabs, MA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The inserted barcoding sequences were annealed using randomized overlapping single stranded oligonucleotides by adding 3 µl of each oligonucleotide (100 µM) to 500 µl 1x 2.1 NEB-buffer (New England Biolabs, Ipswich, MA, USA, #B6002S) followed by boiling at 100 °C for 3 minutes to finally let them associate during the cooling to room temperature ...
-
bioRxiv - Developmental Biology 2021Quote: ... the RNA samples isolated by PureLink Mini kit were subsequently purified by Magnetic mRNA Isolation kit (New England Biolabs, USA). mRNA concentration was estimated by Qubit RNA HS Assay Kit (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2021Quote: ... amplicons were gel purified with the InnuPREP Gel Extraction Kit (Analytik Jena) or the Monarch DNA Gel Extraction Kit (NEB), and submitted for Sanger sequencing (Eurofins Genomics) ...
-
bioRxiv - Developmental Biology 2020Quote: ... RNA was extracted using the Qiagen RNeasy Micro kit and libraries were prepared using the NEBNext Ultra II RNA Library Prep Kit for Illumina (New England BioLabs). All libraries were sequenced on an Illumina HiSeq 2500 with 100 bp single-end reads.
-
bioRxiv - Molecular Biology 2021Quote: ... Adaptor and index primers were added to the sheared DNA fragments using a next-generation sequencing library preparation kit (NEBNext Ultra DNA Library Prep Kit for Illumina; NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... Total RNA was extracted using illustra RNAspin Mini isolation kit (Cytiva) or Monarch Total RNA Miniprep Kit (New England Biolabs) subsequent to spheroblast construction using 10 U of Zymolyase (ZYMO Research ...
-
bioRxiv - Developmental Biology 2019Quote: ... ChIP-seq libraries were prepared using the NEBNext Ultra II library prep kit with the NEB Unique Dual Index primer set kit (New England Biolabs). Samples were sequenced at the Northwestern University NuSeq Core Facility on an Illumina HiSeq 4000 on single-end 50 bp mode ...
-
bioRxiv - Microbiology 2019Quote: ... using Agilent High Sensitivity DNA kit in a Bioanalyzer 2100 instrument then quantitated using qPCR based NEBNext Library Quant Kit for Illumina (New England Biolabs) with a Piko-Real Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2019Quote: ... Total RNA libraries were generated using NEBNext rRNA Depletion kit combined with NEBNext Ultra II Direction RNA Library Prep kit for Illumina (New England Biolabs). We used 100 ng of starting RNA material for input and pre-sorted synaptosomes and 1-5 ng for vGLUT1+ sorted synaptosomes which corresponds to ~100 Mio synaptosomes collected per P3 fractions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Samples with RIN value higher than 8 were processed using the NEBNext poly(A) mRNA Magnetic Isolation kit and the NEBNext Ultra II RNA Library Prep kit for Illumina (New England Biolabs), following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... PCR/reaction cleanup and gel extraction were conducted with the Monarch PCR and DNA cleanup kit and Monarch DNA gel extraction kits (NEB). E ...
-
bioRxiv - Microbiology 2021Quote: ... cholerae and phages was extracted using commercially available kits (Qiagen DNeasy Blood and Tissue or Monarch genomic DNA purification kit (New England BioLabs). For preparation of phage DNA ...
-
bioRxiv - Microbiology 2022Quote: ... After enrichment of mRNA using the Universal Ribodepletion Kit cDNA preparation was performed with the Next Ultra Directional Library Preparation Kit for Illumina (NEB). The cDNA was sequenced on HiSeq 3000 (Illumina ...
-
bioRxiv - Cell Biology 2022Quote: ... 60 ng of total RNA was used for library preparation using NEBNext Ultra II Directional RNA Library Prep Kit for Illumina with NEBNext rRNA Depletion Kit (New England Biolabs). The libraries were paired-end sequenced (2 × 75 bp ...
-
All-trans retinoic acid induces synaptopodin-dependent metaplasticity in mouse dentate granule cellsbioRxiv - Neuroscience 2021Quote: ... and RNA was consecutively isolated using a column based RNA isolation kit according to the manufacturer’s instructions (Monarch® Total RNA Miniprep Kit; #T2010S New England Biolabs). Strand specific cDNA library preparation from polyA enriched RNA (150 bp mean read length ...
-
bioRxiv - Immunology 2019Quote: ... The culture supernatant was projected to perform luciferase assay with Gaussia Luciferase assay kit and Cypridina Luciferase assay kit (NEB) following their description.
-
bioRxiv - Systems Biology 2021Quote: Bulk RNA-seq libraries were prepared from 1000 ng of RNA using the NEBNext Ultra RNA Library Prep kit for Illumina or the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs) as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Enrichment of mRNA was done using the Universal Ribodepletion Kit followed by Next Ultra Directional Library Preparation Kit for Illumina (NEB). The cDNA was sequenced on HiSeq™ 2500 (Illumina ...
-
bioRxiv - Genomics 2021Quote: ... Libraries were constructed from 1 µg of total RNA using Illumina’s TruSeq stranded mRNA Library Preparation Kit or from 500 ng total RNA using NEBNext Ultra II RNA -polyA+ (mRNA) Library Preparation Kit (New England Biolabs) following the manufacturer’s description.
-
bioRxiv - Genetics 2021Quote: ... RNA samples were depleted of rRNA using the QIAseq FastSelect RNA Removal Kit then processed into libraries using the NEBNext Ultra Directional RNA Library Prep Kit for Illumina (NEB) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... Samples were recovered by phenol/CHCl3/isoamyl alcohol extraction twice and purified as per kit instruction using Monarch PCR and DNA cleanup Kit (New England BioLabs). DNA was suspended in 200 ul pre-warm (55°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... or deletions in full-length Gpr161 were generated using Quikchange site-directed mutagenesis kit (Stratagene or Q5 Mutagenesis Kit (NEB).
-
bioRxiv - Molecular Biology 2021Quote: ... RNA-sequencing libraries were prepared with a NEBNext rRNA Depletion Kit and an ENBNext Ultra Directional RNA Library Prep Kit (New England Biolabs). Then ...
-
bioRxiv - Genomics 2022Quote: MNase-seq libraries were prepared from purified nucleosomal DNA using the kit NEBNext Ultra DNA Library Prep Kit for Illumina (cat. # E7370L New England BioLabs) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: RNA was purified by silica-based SPE using Monarch RNA Cleanup Kits (for in vitro assays) or Total RNA Miniprep Kit for intracellular samples (NEB).
-
bioRxiv - Plant Biology 2022Quote: ... Total RNA was isolated using Qiagen RNeasy Plant Mini Kit and cDNA was synthesised using ProtoScript II First Strand cDNA Synthesis Kit (New England Biolabs). SYBR Green Power Up (Thermofisher ...
-
bioRxiv - Plant Biology 2023Quote: ... from 100 to 1000 ng of total RNA using a stranded kit (Illumina TruSeq Stranded Total RNA Kit or NEB Next Ultra™ II Directional RNA Library Prep Kit for Illumina) ...
-
bioRxiv - Cell Biology 2023Quote: ... In vitro transcription was performed with either HiScribe T7 ARCA mRNA kit or the HiScribe In Vitro Transcription Kit (NEB) according to the manufacturer’s recommendation ...
-
bioRxiv - Genomics 2023Quote: ... libraries were prepared either with Nugen Ovation Ultralow V2 DNA-Seq library prep kit (NuGen) or NEBNext Ultra II DNA library prep kit for Illumina (New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Capped RNA was synthesized from the pCS2+hSpCas9 vector using an AmpliCap SP6 High Yield Message Maker Kit (Cell Script) and then purified with a Monarch RNA Cleanup Kit (50 µg) (New England BioLabs).
-
bioRxiv - Neuroscience 2023Quote: RNA was extracted using the QIAzol and the NEB Monarch RNA extraction kit and ribosomal RNA was depleted using the NEBNext rRNA depletion kit (NEB) ...
-
bioRxiv - Genetics 2024Quote: ... was extracted via the UHMW DNA extraction protocol of the Nanobind CBB Big DNA kit (Circulomics) or via the Monarch HMW DNA Extraction Kit for Cells & Blood (New England Biolabs) and quantified using Qubit dsDNA Broad Range kit (ThermoFisher) ...
-
bioRxiv - Microbiology 2023Quote: ... Ribosomal RNA was depleted using the Illumina Ribo-Zero Plus rRNA Depletion kit followed by library preparation with the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs) as per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... and areas corresponding to the expected size were excised and purified from the gel using a gel extraction kit (Monarch DNA Gel Extraction Kit, NEB). Following purification ...
-
bioRxiv - Microbiology 2024Quote: ... The extracted nucleic acid was then subject to library construction using NEBNext Ultra RNA Library Prep Kit and NEB Next Ultra DNA Library Prep Kit (LTD.NEB, China) for RNA and DNA samples ...
-
bioRxiv - Cancer Biology 2021Quote: ... Ligations were performed using Quick Ligation Kit (NEB). Reaction mixes were incubated for 5 min at RT ...
-
bioRxiv - Cancer Biology 2021Quote: ... using Quick Ligation Kit (NEB; Cat. No. M2200L). The ligated DNA was PCR amplified with primers containing Illumina paired-end sequencing adaptors ...
-
bioRxiv - Developmental Biology 2021Quote: ... we used the EnGen sgRNA synthesis kit (NEB) following the manufacturer’s instructions with the following targeting sequences tnpo1 sgRNA#1 (5’-GGCATGGGGGCCACCTCTTG-3’) ...
-
bioRxiv - Developmental Biology 2021Quote: ... NEBNext Ultra II DNA Library Prep Kit (NEB) with 11 cycles of PCR was used to prepare sequencing libraries ...
-
bioRxiv - Microbiology 2022Quote: ... treatment and purification using Monarch Cleanup Kit (NEB). RNA copy number was calculated from its molecular weight and absorbance measured by a NanoDrop 1000 (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2021Quote: ... PolyA selection/enrichment with Ultra II Kit (NEB) was the method adopted for library preparation.
-
bioRxiv - Neuroscience 2021Quote: ... Q5® Site-Directed Mutagenesis Kit (NEB, Inc.) was used to make point mutations to produce five individual EA6-related amino acid substitutions (M128R ...