Labshake search
Citations for New England Biolabs :
1401 - 1450 of 2273 citations for Methyl 4 2 methoxynicotinoyl benzoate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: The pUAST-Ataxin-2-GFP construct was generated by Gibson Assembly® (New England Biolabs, NEB). Briefly ...
-
bioRxiv - Cancer Biology 2024Quote: ... The reaction mixture was then incubated at 37°C for 2 h (New England BioLabs Inc.). The debranched mtDNA was quality-checked using the Genomic DNA ScreenTape assay with the TapeStation system (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2024Quote: ... The libraries were amplified using NEBNext High-Fidelity 2× PCR Master Mix (New England Biolabs, M0541). The libraries were size-selected by adding 1.8X volume Agencourt AMPure XP beads (Beckman ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1 mL of culture was removed and treated with DNase I (New England Biolabs; 4 µL and 25µL of DNaseI buffer) for 1 h at 30 °C to remove any extracellular DNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... Samples were centrifuged for 5 minutes at 5000rpm at 4°C and supernatant treated with 5 mg/ml of proteinase K (New England Biolabs #P8102) for 1 hour at 50°C ...
-
bioRxiv - Cell Biology 2020Quote: ... reaction with 2 to 4 µg of genomic DNA in a 50 µl reaction using the Next High-Fidelity 2x PCR Master Mix (NEB, M0541) (according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... another 1 million cells were processed in only DigWash and during Dam activation incubated with 4 units of Dam enzyme (NEB, M0222L). This Dam control sample serves to account for DNA accessibility and amplification biases.
-
bioRxiv - Genomics 2020Quote: ... Nuclei were pelleted at 1,000 x g for 5 min at 4°C then resuspended in 450 μl of 1X NEBuffer 3 (NEB, cat. # B7003S). Primary restriction enzyme digestion of intact nuclei was carried out overnight at 37°C using 50,000 U of DpnII (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... then incubated for 2 h at 37°C in 100 μl 1x TdT buffer containing 4 μl 10 mM ATP and 1 μl Terminal Transferase (NEB M0315L). Plugs were rinsed with 1 ml tris buffer (10 mM Tris HCl pH 8.0) ...
-
bioRxiv - Genetics 2021Quote: ... Nuclei were pelleted at 500 rcf at 4°C for 5 minutes and resuspended in 90 uL 1X Cutsmart Buffer (NEB B7204S). 10 uL of 10U/uL AluI restriction enzyme (NEB R0137S ...
-
bioRxiv - Neuroscience 2020Quote: ... 10 μl of the reaction was directly used for restriction digest using 4 units of BssHII enzyme (New England Biolabs, USA) in a 20 μl reaction ...
-
bioRxiv - Cancer Biology 2021Quote: ... The left lung lobe was used for histological analysis of tumor development (hematoxylin and eosin) after fixation in 4% formaldehyde (Biolabs, Israel). Right lung lobes were minced and digested with 5 mL digestion buffer ...
-
bioRxiv - Biophysics 2021Quote: An in-frame fusion between the human 5-HT5AR from the Presto-Tango cDNA library (4) and the human Gαi1 was made via HiFi DNA assembly (New England Biolabs, Ipswich, MA). Mutations of key contact points between docked ligands and the human 5-HT5AR binding pocket were made via site-directed mutagenesis as directed (Stratagene ...
-
bioRxiv - Cell Biology 2021Quote: ... 50 mM Tris-Cl pH 7.4, 12 mM MgCl2, 1% NP-40, 0.5 mM DTT, 0.1 mg/ml cycloheximide, 80 U/ml NEB murine RNase inhibitor). Beads were transferred to a fresh tube and immunoprecipitated RNA extracted by incubating beads in buffer RLT (Qiagen ...
-
bioRxiv - Biochemistry 2021Quote: ... libraries were generated using 5 μl of the purified RT reaction product and 4-8 cycles of PCR with Q5 high fidelity polymerase (NEB, M0491S). PCR reaction products were column purified ...
-
bioRxiv - Microbiology 2020Quote: ... and internal transcribed spacer 4 (ITS4) (5′ TCCTCCGCTTATTGATATGC 3′) primers,27 along with the Phusion High Fidelity DNA polymerase (New England Biolabs, Ipswich). Touch-down method of PCR was used for increased specificity of primer amplification in a Surecycler 8800 (Agilent Technologies ...
-
bioRxiv - Systems Biology 2021Quote: ... for each oligo pool we used 50 femtomoles of template and 4 cycles of PCR in each of multiple 50 microliter reactions (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Plant Biology 2021Quote: ... and cloned into Gateway™ pENTR™ 4 by mixing the linearized vector backbone and PCR product in a 1:1 ratio using Gibson assembly (NEB), before transformation into DH10B electro-competent E ...
-
bioRxiv - Microbiology 2021Quote: ... All generated plasmids of this study (Table 4) were cloned with restriction endonucleases and T4 ligase from NEB (New England Biolabs) or Gibson assembly (NEBuilder® HiFi DNA Assembly ...
-
bioRxiv - Cancer Biology 2020Quote: ... we performed eight 100 μl PCR reactions per sample (4 μg DNA per reaction, 32 μg per mouse) using Q5 High-Fidelity 2x Master Mix (New England Biolabs, M0494X). The PCR products were purified with Agencourt AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 μl of the diluted samples was then denatured by addition of 4 M urea and Proteinase K (40 U/ml; New England Biolabs #P8107S), incubated for 5 min at 65°C ...
-
bioRxiv - Microbiology 2022Quote: ... containing ampicillin resistance marker were amplified by PCR with corresponding primers (Supplementary Data 4) in Q5® High-Fidelity 2X Master Mix (New England BioLabs). Both the insert (MCR-MOR ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was generated from RNA using 4 µL of 5X ProtoScript II buffer (cat. n° M0368L, NEB, New England Biolabs, USA), 2 µL of 0.1 M Dithiothreitol (cat ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was generated from RNA using 4 µL of 5X ProtoScript II buffer (cat. n° M0368L, NEB, New England Biolabs, USA), 2 µL of 0.1 M Dithiothreitol (cat ...
-
bioRxiv - Cancer Biology 2020Quote: ... the oligonucleotides containing the different gRNA-pairs (Supplementary Table 4) were amplified with Phusion High-Fidelity polymerase (New England Biolabs, M0530S) using primer F5 and R1 (Supplementary Table 2) ...
-
bioRxiv - Synthetic Biology 2022Quote: All pLS plasmids listed in Supplementary Table 4 were synthesized as gBlocks by IDT and circularized either by ligation with T4 DNA ligase (New England Biolabs, USA), or ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μg of the extracted genomic DNA was digested for 4 h at 37☐ using 10 U MmeI (New England Biolabs). The DNA was then immediately dephosphorylated by treatment with 1 U calf intestine alkaline phosphatase (Invitrogen ...
-
bioRxiv - Molecular Biology 2021Quote: ... mCherry and control (GAPDH) expression levels were measured separately by qPCR from 4 uL of diluted cDNA using Taq DNA Polymerase (NEB, #M0270L), dsGreen DNA detection dye (Lumiprobe ...
-
bioRxiv - Genetics 2023Quote: ... 4 µg of DNA in 80 µl reaction were incubated at 37°C for seven minutes and randomly fragmented to 300 bp – 4 kb size products using NEBNext® dsDNA Fragmentase (New England BioLabs) and then cleaned using 0.5x SPRI beads ...
-
bioRxiv - Microbiology 2024Quote: ... the purified PCR products were ligated with the empty vectors in a molar ratio of 1:4 using T4 DNA ligase (NEB, USA) at 16 °C overnight ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4 μg of venom in 10 µL of reducing SDS-PAGE buffer (6X stock solution, NEB B7024S with 30% β-mercaptoethanol) was run per lane on BioRad™ Mini PROTEAN pre-cast TGX acrylamide gels (15 well ...
-
bioRxiv - Cell Biology 2024Quote: ... The RNase III-treated samples were pre-incubated with 4 U of RNase III (New England Biolabs, Ipswich, Massachusetts, USA, M0245S) in reaction supplemented by 20 mM MnCl2 at 15 °C for one hour ...
-
bioRxiv - Microbiology 2024Quote: ... acidocaldarius DSM 639 wild type using the primers (Eurofins Genomics) listed in supplementary Table 4 employing the Q5 polymerase (NEB, USA) following the manufacturers’ instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Digestion products were diluted by the addition of 4 mL 1.1× T4 DNA Ligase Reaction Buffer (New England BioLabs® Inc) with 1% Triton X-100 and incubated for 1 h at 37°C ...
-
bioRxiv - Neuroscience 2022Quote: ... Three to four independently generated PCR products for each OT1-4/founder were purified using the Monarch PCR & DNA Cleanup Kit (NEB Inc.) and sent for Sanger sequencing at the OHSU Vollum Sequence Core.
-
bioRxiv - Microbiology 2022Quote: ... Purified protein (4 μg) was deglycosylated with 500 U of Endoglycosidase H (Endo H) (New England Biolabs, Ipswich, MA, United States) according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2022Quote: ... with a terminal elongation step for 4 min at 72°C employing a proofreading Taq polymerase (Q5 High-Fidelity DNA polymerase, New England Biolabs, Germany). After verification of the amplicon sequence ...
-
bioRxiv - Genetics 2023Quote: ... After 48 h cells were incubated for 30 min at 37 °C with SNAP-Oregon green (NEB, final concentration 4 µM). Cells were then incubated for 30 min at 37 °C in fresh media to wash off unbound substrate ...
-
bioRxiv - Cancer Biology 2023Quote: ... then incubated for 2 h at 37°C in 100 μl 1x TdT buffer containing 4 μl 10 mM ATP and 1 μl Terminal Transferase (NEB M0315L). Plugs were rinsed with 1 ml Tris buffer (10 mM Tris HCl (pH 8.0)) ...
-
bioRxiv - Plant Biology 2024Quote: RNA was isolated from leaves 4 and 5 using Trizol and cDNA was synthesized using MuMLV reverse transcriptase (New England Biolabs, Inc.) primed with random hexamers ...
-
bioRxiv - Biophysics 2024Quote: ... The N-glycans of Fc were unified by adding 1 nmol of β1-4 Galactosidase S (New England Biolabs, Tokyo, Japan) per 1 unit of glycan terminus (mixed so that the enzyme solution was 10% of the total reaction solution ...
-
bioRxiv - Biochemistry 2024Quote: The coding sequence of human EIF4EBP1 (NM_004095.4) was amplified from cDNA derived from HepG2 cells using primers containing restriction sites using Q5 polymerase (New England Biolabs, M0491). PCR products were cloned into suitable vectors using restriction digest followed by ligation ...
-
bioRxiv - Systems Biology 2024Quote: ... Total RNA was extracted from each sample (+/- SIRLOIN/TSO, nuclei and whole cells, 4 samples total) with the NEB Total RNA Miniprep kit (NEB #T2010). 10 ng nuclear RNA and 100 ng whole-cell RNA was used as template for RT-qPCR using the NEB Luna Universal One-Step RT-qPCR kit (NEB #E3005) ...
-
bioRxiv - Bioengineering 2024Quote: ... The plasmid pool was then digested with the outer guides M1 and P1 (5 μg plasmid pool, 10 μL M1+P1 Cas9 RNP, 4 μL 10X rCutSmart buffer (NEB, B6004S), and H2O to 40 μL incubated at 37°C for 1 hour) ...
-
bioRxiv - Cancer Biology 2021Quote: ... ΔN1/2/3 and ΔDAD mutants were generated by Q5® Site-Directed Mutagenesis Kit (NEB, E0554S) with HOXB13 WT or NCOR1 WT as a template ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Extracted RNA was treated with 2% RNase-free DNase I (New England BioLabs Japan Inc., Tokyo, Japan) at 37°C for 40 minutes and purified by phenol/chloroform extraction and ethanol precipitation.
-
bioRxiv - Molecular Biology 2020Quote: ... cells were incubated with 2 nM HaloTag-JF549 and 5 nM SNAP-Cell® 647-SiR (NEB) before imaging.
-
bioRxiv - Molecular Biology 2021Quote: ... Samples were then incubated at 45 °C for 2 hr with 5 μL of Proteinase K (NEB) in the presence of 40 mM EDTA (pH 8.0 ...
-
bioRxiv - Genomics 2022Quote: ... 7 μl PEG 8000 (17.5% final) and 1 μl of T4 RNA ligase 2 KQ (NEB, M0373L) in 1X T4 RNA ligase buffer ...
-
bioRxiv - Microbiology 2021Quote: ... total RNAs were extracted from Caco-2 cells and followed by mRNA purification (Oligo dT beads, NEB). The mRNAs were fragmented and converted into double-stranded DNA by reverse transcription and then second-strand synthesis (NEB) ...