Labshake search
Citations for New England Biolabs :
1401 - 1450 of 7751 citations for 6 methyl 5 4 phenyl 1 3 thiazol 2 yl 2 trifluoromethyl nicotinic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2024Quote: ... the DNA-bound beads were digested with 2 μl BpmI (NEB, catalog number R0565L) for 30 min at 37 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 μM of dsDNA was incubated with CpG methyltransferase (M. SssI, New England Biolabs) in the presence of 200 μM of S-adenosylmethionine ...
-
bioRxiv - Immunology 2024Quote: ... washed in 10 mL RPMI+10% FBS + 2 µl RNase-free DNase I (NEB), and placed in single-cell suspension in 1 mL RPMI+10% FBS ...
-
bioRxiv - Immunology 2024Quote: ... washed in 10 mL RPMI+10% FBS + 2 µl RNase-free DNase I (NEB), and stained with LIVE/DEAD Aqua for 15 minutes at room temperature ...
-
bioRxiv - Developmental Biology 2024Quote: ... Libraries were generated via PCR amplification using NEBNext HighFidelity 2× PCR Master Mix (NEB). The resultant libraries were purified again using the MinElute PCR Purification Kit (Qiagen) ...
-
bioRxiv - Genomics 2024Quote: ... 0.4 µL RNase Inhibitor and 2 µL Induro RT (200 U/µL; NEB M0681S) were incubated for 15 minutes at 60°C ...
-
bioRxiv - Genetics 2023Quote: ... 1 ul of 5 mM 7-deaza-dGTP (NEB), 1 ul of 25 mM MgCl2 (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: ... nucleic acid (5 μL) was used as template for reverse transcription using LunaScript® RT SuperMix Kit (New England Biolabs, Hitchin, UK) in 20 μL reaction volume ...
-
bioRxiv - Genomics 2024Quote: ... Samples were then rinsed with 2X SSC before incubating with a blocking buffer (10% BSA, 3% v/v 6% v/v murine RNase inhibitor [NEB, M0314L] in 2X SSC) for 30 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... 15 µL 10x T4 ligase buffer, 3 µL 50 mg/mL BSA, 1.5 µL 2000U/µL T4 ligase, NEB, 6 µL BLISS adapter pairs). For removal of excess adapters ...
-
bioRxiv - Neuroscience 2023Quote: ... a 3′ RNA adapter with a phosphate on its 5’ (5’- /5Phos/r(N:25252525)r(N:25252525)r(N:25252525)rUrGrGrArArUrUrCrUrCrGrGrGrUrGrCrC rArArGrG/3SpC3/-3’) end was ligated to RNA 3’ ends using T4 RNA ligase 1 (NEB, M0437) at 25 °C for 75 min (with gentle agitation every 10 min) ...
-
bioRxiv - Microbiology 2020Quote: ... and a “bottom” strand with sequence 5’-AAAAC-(30bp spacer reverse complement)-3’ were phosphorylated with PNK (NEB, M0201S) in a 50 μL reaction volume (1.5 μL 100 uM top oligo ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 5’ end of the first block and the 3’ end of the last block contained SapI (NEB, R0569) recognition sites instead ...
-
bioRxiv - Molecular Biology 2020Quote: ... Selectively captured polyadenylated RNAs (1μg) were ligated directly to an DNA/RNA hybrid adapter (5’-CTACAC GACGCTrCrUrUrCrCrGrArUrCrUrNrNrN-3’) using T4 RNA ligase (NEB) at 37°C for 30 minutes ...
-
bioRxiv - Genomics 2019Quote: ... was hybridized to the 3’ adapter and the 5’ adapter ligated by adding 2μL T4 RNA ligase buffer (NEB), 5μL PEG 8000 (NEB) ...
-
bioRxiv - Bioengineering 2019Quote: ... The PCR product was inserted into pcDNA3.1 via 5’EcoRI/3’NotI restriction digestion and a standard ligation protocol (T4 DNA Ligase; New England BioLabs) to create pcDNA3.1-Ncadherin ...
-
bioRxiv - Biochemistry 2021Quote: ... Construct included 5’ and 3’ complementary overhangs for ligation into pPICZαA using NEBuilder HiFi DNA Assembly (New England Biolabs) to form pPICZαA_GH43_34 ...
-
bioRxiv - Plant Biology 2021Quote: ... samples were incubated for 5 min on ice and 3 μL of 10X G5 buffer (New England BioLabs, UK) were added to the samples together with 1.5 μL of 25X concentrated protease inhibitor cocktail (Roche ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the second linker SI183 5’-/Phos/NNAGATCGGAAGAGCGTCGTGTAGGGAAAGAG/ddC/-3’ was preadenylated by Mth RNA Ligase (New England Biolabs) as described previously8 ...
-
bioRxiv - Genomics 2023Quote: The standard HiDEF-seq v2 protocol was followed with the exception of replacing Klenow fragment 3’→5’ exo-polymerase with one of the following: 9.6 U Bst large fragment (NEB), 9.6 U Bst 2.0 (NEB) ...
-
bioRxiv - Genomics 2023Quote: ... 5 µg of genomic DNA was dephosphorylated by 3 µL of Quick Calf Intestinal Phosphatase (CIP, New England Biolabs) in a total volume of 30 µL for 10 min at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... the 5’-PPP RNA in the total RNA was specifically capped with 3’-Desthiobiotin-GTP (New England BioLabs, N0761) by the Vaccinia Capping System (New England BioLabs ...
-
bioRxiv - Plant Biology 2024Quote: ... This end-repaired DNA was subjected to A-tailing using the Klenow 3′–5′ exo− enzyme (New England Biolabs). The subsequent step involved the ligation of methylated adapters to the A-tailed DNA ...
-
bioRxiv - Genomics 2024Quote: ... Two cycles of whole genome amplification were performed using 50 U of Klenow Fragment (3’→5’ exo-) (NEB, M0212M), dNTP solution mix (Bio-Rad ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2020) and 5’Ncol1::mScarlet::3’Ncol119 plasmids using Gibson assembly according to the manufacturer recommendations (NEB, CAT#E2611). Sequences of Gibson primers used were:
-
bioRxiv - Genomics 2022Quote: The crRNAs and tracRNA (see Extended Table 3) were mixed 1:1 to 1 μM in supplied buffer 3.1 (NEB) with 0.2 U/μl RNaseOUT™ (Invitrogen) ...
-
bioRxiv - Bioengineering 2021Quote: ... 1 µL linearized expression plasmid was assembled with 3 µL each of PCR amplified product using 4 µL of NEBuilder HiFi DNA Assembly MasterMix (#E2621L, New England Biolabs) in a 96-well plate format ...
-
bioRxiv - Molecular Biology 2021Quote: ... was digested with PmeI and SacII restriction enzymes for 3 to 4 hours at 37°C and dephosphorylated using Antarctic Phosphatase (NEB) for 1 hour at 37°C ...
-
bioRxiv - Microbiology 2022Quote: ... Backbone was amplified with primer pair 3/4 and fragments were assembled with NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs).
-
bioRxiv - Biochemistry 2019Quote: ... a 5’ RNA adapter (GCAATTAACCCTCACTAAAGGAGTCGT) lacking 5’ phosphate was ligated with T4 RNA Ligase 1 (NEB #M0204S). Ligation products were gel-purified ...
-
bioRxiv - Genomics 2023Quote: ... The DNA length and RNA absence were assessed by 2% agarose gel electrophoresis (50 V, 90 min) including the Quick-Load 1 kb DNA Ladder (New England Biolabs Inc., Ipswich, USA; Text S1). The extracted gDNA was not fragmented and larger than 10 kb (Fig ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were then pulse labelled with tetra-methyl-rhodamine-conjugated SNAP substrate (TMR-Star; New England Biolabs) at 4 µM final concentration ...
-
bioRxiv - Cancer Biology 2022Quote: ... The constructs were subjected to treatment with NEBNext® Enzymatic Methyl-seq (EM-seq™) (NEB, #E7125) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... except that the methyl donor SAM was absent and 0.05 units of inorganic pyrophosphatase (New England Biolabs) were added to improve the efficiency of the reaction ...
-
bioRxiv - Genetics 2023Quote: ... Enzymatic conversion was performed using the NEBNext Enzymatic Methyl-seq Conversion Module (New England BioLabs, Cat#E7125S) according to the manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2023Quote: ... SssI enzyme in the presence of 160 µM of the methyl donor S- adenosylmethionine (New England BioLabs) for 4 hours at 37°C ...
-
bioRxiv - Genomics 2024Quote: ... 200ng of each sample was enzymatically converted using the NEBNext® Enzymatic Methyl-seq Kit (NEB, E7120) with the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2020Quote: ... and 30 μg was diluted 1:3 in gel loading buffer (NEB), sonicated ...
-
bioRxiv - Genomics 2022Quote: ... 3′ Adapter ligation was done using T4 RNA Ligase 1 (NEB, M0204L). A first binding to streptavidin beads (NEB ...
-
bioRxiv - Plant Biology 2024Quote: ... ble cassette and 1 kb 3’ homologous arm onto the BamHI (NEB) digested backbone of pUC57 ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 μM CaCl2) and digested with 1/100 MNase (New England Biolabs). After addition of 250 µL sonication buffer (90 mM Hepes pH 7.9 ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 mM DTT) were treated with 3 ul (15 units) RNaseH1 (NEB) or H20 as a control and incubated at 37°C for 2 hr with slight agitation (300 rpm) ...
-
bioRxiv - Cell Biology 2024Quote: ... The 3′ cDNA adapter was ligated by T4 RNA ligase 1 (NEB) by incubating at 25 °C for 16h ...
-
bioRxiv - Genetics 2021Quote: ... 0.5 μM MPRA_v3_F and MPRA_v3_20I_R primers (Supplementary Table 14) and 2 ng BSA (NEB, B9000). PCR master mix was emulsified by vortexing with 220 μL Tegosoft DEC (Evonik) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... treated ~2 μg RNA with RNase-free DNase I (Catalog# M0303S NEW ENGLAND Biolabs, USA), then used 1 μL treated RNA in cDNA synthesis with SuperScript III Reverse Transciptase (Invitrogen ...
-
bioRxiv - Molecular Biology 2022Quote: pLXV-EF1alpha-2xStrep-SARS-CoV-2-nsp14-IRES-Puro was opened with BsrGI-HF (NEB) and EcoRI-HF (NEB) ...
-
bioRxiv - Developmental Biology 2022Quote: ... samples were washed in PBS-T and blocked in PBS-T + 2% BSA (NEB, B9000) + 5% donkey/goat serum (Jackson Immunoresearch/Dianova ...
-
bioRxiv - Molecular Biology 2020Quote: ... or 500 ng of chromatin-bound or nucleoplasmic RNA with 2 µl Quick CIP (NEB) in a total volume of 20 µl for 90 min at 37°C ...
-
bioRxiv - Immunology 2021Quote: ... PCRs were performed with Phusion High-Fidelity DNA Polymerase (2 U/µL) (New England Biolabs) in a total volume of 50 μl ...
-
bioRxiv - Bioengineering 2020Quote: ... PCR was performed using Q5® High-Fidelity 2× Master Mix (New England Biolabs, US). The point mutation in dCas9 to create H840A Cas9n was made using Q5® Site-Directed Mutagenesis Kit (New England Biolabs ...